ID: 942031230

View in Genome Browser
Species Human (GRCh38)
Location 2:171962280-171962302
Sequence TTCTAGTTAGATATTCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942031230_942031233 22 Left 942031230 2:171962280-171962302 CCTACCAGAATATCTAACTAGAA No data
Right 942031233 2:171962325-171962347 AAAATAAATTACCAAGCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942031230 Original CRISPR TTCTAGTTAGATATTCTGGT AGG (reversed) Intronic
No off target data available for this crispr