ID: 942034726

View in Genome Browser
Species Human (GRCh38)
Location 2:171999832-171999854
Sequence TGCGCGCGCGGGGCTGACTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942034726_942034740 23 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034740 2:171999878-171999900 CGACGCCTCAGGGCTTCGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 47
942034726_942034730 -7 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034730 2:171999848-171999870 GCGCGCACGCGCGCTCCCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 115
942034726_942034731 -6 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034731 2:171999849-171999871 CGCGCACGCGCGCTCCCCTCGGG 0: 1
1: 0
2: 1
3: 12
4: 79
942034726_942034736 12 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034736 2:171999867-171999889 TCGGGCGGCCTCGACGCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 54
942034726_942034737 13 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034737 2:171999868-171999890 CGGGCGGCCTCGACGCCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 35
942034726_942034741 24 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034741 2:171999879-171999901 GACGCCTCAGGGCTTCGGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
942034726_942034738 19 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034738 2:171999874-171999896 GCCTCGACGCCTCAGGGCTTCGG 0: 1
1: 0
2: 2
3: 8
4: 126
942034726_942034732 -3 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034732 2:171999852-171999874 GCACGCGCGCTCCCCTCGGGCGG 0: 1
1: 1
2: 1
3: 8
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942034726 Original CRISPR TGCGCGCGCGGGGCTGACTG CGG (reversed) Exonic
900180227 1:1307981-1308003 TGCGCGCGGGCGGCTGACTTTGG - Exonic
900528300 1:3139994-3140016 TGCGTCGCCGGGGCTGACTGCGG - Intronic
900916572 1:5643820-5643842 TGAGCTCGCGGGGCAGGCTGGGG - Intergenic
900992896 1:6106150-6106172 TGCAGGGGCAGGGCTGACTGTGG + Intronic
901059663 1:6466166-6466188 TGCGGGCGCGGGGCTGAAGGCGG - Exonic
901928025 1:12579253-12579275 TGCACGCCCGGGGCTGGCTCTGG + Intronic
903215137 1:21839534-21839556 GGTGGGCGCGGGGCTGCCTGTGG + Exonic
904162294 1:28530742-28530764 TGCGCGCCCGGGGCTCTCTGTGG - Intronic
905066839 1:35192077-35192099 TGCGGGGGCGGGGCGGCCTGCGG - Intronic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
914746702 1:150506466-150506488 TGCGCGCGCGTGTCTGAAGGGGG - Intronic
917966868 1:180184266-180184288 TGCGGGGCCGGGGCTGACTGGGG + Intronic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923506283 1:234609163-234609185 GGCGCGCGCGGGGCCGCCTCGGG + Exonic
923663646 1:235979898-235979920 TGCGTCTGCTGGGCTGACTGGGG + Exonic
924763120 1:247007632-247007654 TGCGGGCGCGGGGCTGCCCCGGG + Intronic
1062843814 10:689789-689811 AGCGCGCGCGGGGCGGGCCGGGG - Intergenic
1067683344 10:48453713-48453735 TGCAGGGGCGGCGCTGACTGGGG - Intronic
1073292384 10:102419638-102419660 GGGGCGCGCGGGGCTCACCGCGG + Intronic
1076789149 10:132767669-132767691 TGGGCGCGAGGGGCTCTCTGGGG - Intronic
1078266292 11:9758311-9758333 CGGGCGCGCGGGGCCGACTAGGG + Intergenic
1081626919 11:44661567-44661589 TGAGCTGGCGGGGCTGGCTGGGG - Intergenic
1084164116 11:67367117-67367139 TGCGCGGGCGGGGTTGGGTGGGG - Intronic
1087014522 11:93542926-93542948 TGCGGGTGCGGGGCGGACTCAGG - Intronic
1089845161 11:121452512-121452534 TGGGCGCGCGGGGATGCCAGGGG + Exonic
1090788350 11:130069582-130069604 TGTGGGCGCGGGGCTGGCTCTGG - Intergenic
1103441610 12:120967083-120967105 TTCGGTCGCGGGGCTGGCTGAGG - Intergenic
1104884038 12:132094466-132094488 TGCTTGAGAGGGGCTGACTGTGG + Intronic
1105004245 12:132711067-132711089 GGTGCGCGCGGGGCTGTTTGGGG + Exonic
1105571168 13:21604105-21604127 TGCGCGCGGGTGGCGGCCTGGGG - Exonic
1110521821 13:76488406-76488428 TGTGCTCACAGGGCTGACTGGGG + Intergenic
1113899199 13:113787172-113787194 CGCGTGCACGTGGCTGACTGTGG - Intronic
1122582091 14:102777442-102777464 TGCCTGCGCGGGGCTGCGTGAGG + Intergenic
1122633830 14:103121191-103121213 TGCGTGCGAGGAGCTGACCGTGG + Intergenic
1123004452 14:105314678-105314700 GGCGCGCGCGGGGCGGCCGGGGG + Exonic
1123041421 14:105491770-105491792 TGCCGGGGCGGGGCTTACTGGGG - Intronic
1127165791 15:56243854-56243876 TGCGCGCACTGGGCTGCCTCCGG - Intergenic
1130625750 15:85512707-85512729 TGCAGGTGAGGGGCTGACTGAGG - Intronic
1132186717 15:99807036-99807058 TCCTGGCGCGGGGCTGACTCGGG + Intergenic
1132428970 15:101745675-101745697 TCCTGGCGCGGGGCTGACTCGGG - Intronic
1132875652 16:2135777-2135799 GGCGGGCGCGGGGCTGGATGGGG + Exonic
1134519333 16:14911576-14911598 GGCGGGCGCGGGGCTGGATGGGG - Intronic
1134554599 16:15154652-15154674 GGCGGGCGCGGGGCTGGATGGGG + Intergenic
1134707003 16:16310231-16310253 GGCGGGCGCGGGGCTGGATGGGG - Intergenic
1134960537 16:18401893-18401915 GGCGGGCGCGGGGCTGGATGGGG + Intergenic
1136927633 16:34389094-34389116 TGAGCCCGCGGGGTTGGCTGGGG + Intergenic
1136976941 16:35022712-35022734 TGAGCCCGCGGGGTTGGCTGGGG - Exonic
1139484045 16:67246383-67246405 TGCCTGCGGGGGGCTGACGGCGG + Intronic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1142206549 16:88785542-88785564 TGCGCGTGGGGCGCTGCCTGGGG - Intergenic
1152714434 17:81891689-81891711 TGCGCGCGCGGGACGGGGTGAGG + Intronic
1152759053 17:82098758-82098780 TGCCCGCGCGGAGCTGGCTGAGG + Intergenic
1153900656 18:9614611-9614633 CGCGCGCGCGGGGCGGGCCGAGG + Intronic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1160454755 18:78992710-78992732 GGCGGCCGCGGGGCTGAGTGAGG - Exonic
1160947954 19:1652218-1652240 AGCGCGCGCGGGGCGGGCCGGGG + Intronic
1160970604 19:1766245-1766267 TGCCCGCGTGGGGCTGCCTGAGG - Intronic
1161086248 19:2336804-2336826 TGTGCGCGCTGGCCTGGCTGCGG + Intronic
1161103940 19:2434145-2434167 TGCGTGCCCTGGGCTGTCTGGGG - Intronic
1162970073 19:14175442-14175464 TGAGCGGGTGTGGCTGACTGAGG - Intronic
1165552987 19:36604809-36604831 TGGGCCCGCGGGACTGAGTGGGG - Intronic
1166330703 19:42076488-42076510 GTCGCGTGCGGGGCTGAGTGAGG + Intronic
1166876641 19:45901836-45901858 AGGGCGCACGGGGCTGGCTGGGG + Intronic
1167494515 19:49809666-49809688 CGCGAGCTCGGGGCTGGCTGTGG - Intronic
1202648604 1_KI270706v1_random:161494-161516 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
926199801 2:10786388-10786410 TGCCGGCGGGGGGCAGACTGTGG - Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934534536 2:95121980-95122002 GGCGCCCGCGGGGCTGTCCGCGG - Exonic
936267290 2:111020300-111020322 TGCGAGCGCTGCTCTGACTGGGG - Intronic
938541367 2:132286526-132286548 TGGGTGCCTGGGGCTGACTGCGG + Intergenic
941099667 2:161282115-161282137 TGTGTGCCTGGGGCTGACTGTGG - Intergenic
942034726 2:171999832-171999854 TGCGCGCGCGGGGCTGACTGCGG - Exonic
947622726 2:231601103-231601125 AGCTCCCGCGGGGCTGGCTGGGG + Intergenic
948443843 2:238016666-238016688 TTCTCGGGCGGGGCTGCCTGTGG + Intronic
948483386 2:238264344-238264366 TGTGTCCGCGGGGCTGCCTGGGG - Intronic
948511123 2:238466062-238466084 CGCGCGCCCCGGGCTGCCTGTGG + Intergenic
1168801378 20:645578-645600 TGCACGCGCAGGGCTGAAAGAGG - Intergenic
1171209141 20:23303567-23303589 TCCCCCCGCGGGGCTGGCTGAGG + Intergenic
1171870268 20:30519548-30519570 TGAGTGCCTGGGGCTGACTGCGG + Intergenic
1173221587 20:41136927-41136949 GGCGGGGGCGGGGCTGCCTGCGG - Intergenic
1175429489 20:58891576-58891598 GGAGCGCGCGGGGCGGACTGCGG - Intronic
1176603250 21:8811193-8811215 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1180345536 22:11702750-11702772 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1180352183 22:11814562-11814584 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1180353298 22:11820991-11821013 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1180384942 22:12171366-12171388 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1180386024 22:12177504-12177526 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1181151916 22:20890322-20890344 TGCCAGGGCTGGGCTGACTGTGG + Exonic
1182289829 22:29268556-29268578 GGCGCGCGGGGGGCTTGCTGCGG + Intronic
1183299752 22:37053033-37053055 TGCGTGTGCGGGGTTGGCTGGGG + Intronic
1183427236 22:37746428-37746450 CGGGCGCGGGCGGCTGACTGGGG - Intronic
1184043438 22:41957936-41957958 TGGGCGGGCGGGGCGGGCTGGGG - Intergenic
1184252015 22:43266190-43266212 GGCTCGCGCGGGCCTGACTGGGG - Intronic
1184465952 22:44668955-44668977 CGCGCGCGCGACGCCGACTGCGG + Intronic
1184523796 22:45009847-45009869 GGCGCGCGCGGGGCTGCGCGGGG - Intronic
1184712720 22:46262750-46262772 CACGCGCGCGGGGCCGTCTGTGG + Exonic
968514113 4:1009366-1009388 TGCGCGCCTGGGGCTCACCGGGG + Intergenic
969344864 4:6564030-6564052 TGCGGGCGCGGGGCGGGGTGTGG + Intergenic
973374829 4:49279458-49279480 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973375733 4:49285480-49285502 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973376632 4:49291499-49291521 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973377551 4:49297651-49297673 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973378470 4:49303787-49303809 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
973379691 4:49311576-49311598 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
973380592 4:49317716-49317738 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
973381678 4:49324761-49324783 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
973382582 4:49330783-49330805 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
973386195 4:49515832-49515854 TGGGTGCCAGGGGCTGACTGTGG - Intergenic
978154547 4:105474071-105474093 TGTGCGCGCGGAGCTACCTGGGG + Exonic
981782263 4:148442999-148443021 TCCGCGCGCGGGGAGGACTCTGG + Intronic
1004720593 6:18264700-18264722 TGCGCGCGCGGGGCTCTCCCCGG + Exonic
1007479828 6:42142556-42142578 TGCGCGGGCGGGGAGGACGGCGG - Intronic
1007902466 6:45423605-45423627 TGGGCGTGGGGTGCTGACTGAGG + Intronic
1019302384 7:312993-313015 TTTGCCCGCGGCGCTGACTGAGG - Intergenic
1021426925 7:20510878-20510900 AGCCCGAGAGGGGCTGACTGGGG - Intergenic
1023812916 7:43926403-43926425 TGCGCGCGCGGGGCACTGTGGGG - Intronic
1024285987 7:47758010-47758032 TGGGCGAGCGTGCCTGACTGTGG - Intronic
1028985655 7:97006516-97006538 AGGGCGCGCGGGGCCGCCTGGGG - Intronic
1029054924 7:97732201-97732223 TGCCCGCGCGGTGCTGGCCGCGG + Intronic
1037952336 8:23027578-23027600 TGGGTGCTCTGGGCTGACTGTGG - Intronic
1041068090 8:54101655-54101677 TGCGGGCGCGTGGCGGCCTGCGG - Intronic
1049062118 8:140284793-140284815 GGTGAGCACGGGGCTGACTGAGG - Intronic
1049660142 8:143816170-143816192 TGGGTGGGCGGGGCTGCCTGGGG - Intergenic
1049685878 8:143939166-143939188 GGCGCCCGCGAGGCTGACGGGGG - Intronic
1049988281 9:971671-971693 TGCCCGCGCGCCGCTGACTCTGG + Intergenic
1061075733 9:128340492-128340514 TGCGCGAGCAGGGCGGGCTGGGG + Intergenic
1061084921 9:128393118-128393140 TGCGTGCGCGGGGCTGGGCGGGG - Intergenic
1061252891 9:129437051-129437073 CGCGCGCGCGTGCCTGACCGCGG + Intergenic
1061517180 9:131096690-131096712 TGTGCGCGCCGGGCGGACCGCGG + Intronic
1061823228 9:133239993-133240015 TGAGCCCACGGTGCTGACTGGGG + Intergenic
1061975887 9:134067900-134067922 TGCGCGCGCGGGGCGGCGGGCGG - Intronic
1062268785 9:135699509-135699531 TGAGGGGGCGGGGCTGCCTGCGG - Exonic
1062551159 9:137087223-137087245 GGGTCGCGCCGGGCTGACTGGGG + Intronic
1203698539 Un_GL000214v1:117563-117585 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203699458 Un_GL000214v1:123714-123736 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203700404 Un_GL000214v1:129997-130019 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203480149 Un_GL000224v1:4600-4622 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203481116 Un_GL000224v1:10928-10950 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203482080 Un_GL000224v1:17237-17259 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203548645 Un_KI270743v1:150957-150979 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203549772 Un_KI270743v1:157448-157470 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1203550711 Un_KI270743v1:163613-163635 TGGGTGCCTGGGGCTGACTGTGG - Intergenic
1203568109 Un_KI270744v1:108708-108730 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1203569750 Un_KI270744v1:119951-119973 TGGGTGCCTGGGGCTGACTGTGG + Intergenic
1195384951 X:104305322-104305344 GGCACGCCCGGTGCTGACTGTGG - Intergenic