ID: 942034726

View in Genome Browser
Species Human (GRCh38)
Location 2:171999832-171999854
Sequence TGCGCGCGCGGGGCTGACTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942034726_942034732 -3 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034732 2:171999852-171999874 GCACGCGCGCTCCCCTCGGGCGG 0: 1
1: 1
2: 1
3: 8
4: 57
942034726_942034731 -6 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034731 2:171999849-171999871 CGCGCACGCGCGCTCCCCTCGGG 0: 1
1: 0
2: 1
3: 12
4: 79
942034726_942034736 12 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034736 2:171999867-171999889 TCGGGCGGCCTCGACGCCTCAGG 0: 1
1: 0
2: 0
3: 4
4: 54
942034726_942034730 -7 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034730 2:171999848-171999870 GCGCGCACGCGCGCTCCCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 115
942034726_942034740 23 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034740 2:171999878-171999900 CGACGCCTCAGGGCTTCGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 47
942034726_942034737 13 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034737 2:171999868-171999890 CGGGCGGCCTCGACGCCTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 35
942034726_942034741 24 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034741 2:171999879-171999901 GACGCCTCAGGGCTTCGGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 68
942034726_942034738 19 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034738 2:171999874-171999896 GCCTCGACGCCTCAGGGCTTCGG 0: 1
1: 0
2: 2
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942034726 Original CRISPR TGCGCGCGCGGGGCTGACTG CGG (reversed) Exonic