ID: 942034738

View in Genome Browser
Species Human (GRCh38)
Location 2:171999874-171999896
Sequence GCCTCGACGCCTCAGGGCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942034729_942034738 7 Left 942034729 2:171999844-171999866 CCGCGCGCGCACGCGCGCTCCCC 0: 1
1: 0
2: 6
3: 51
4: 356
Right 942034738 2:171999874-171999896 GCCTCGACGCCTCAGGGCTTCGG 0: 1
1: 0
2: 2
3: 8
4: 126
942034727_942034738 9 Left 942034727 2:171999842-171999864 CCCCGCGCGCGCACGCGCGCTCC 0: 1
1: 2
2: 8
3: 53
4: 323
Right 942034738 2:171999874-171999896 GCCTCGACGCCTCAGGGCTTCGG 0: 1
1: 0
2: 2
3: 8
4: 126
942034724_942034738 28 Left 942034724 2:171999823-171999845 CCAGGGCTCCCGCAGTCAGCCCC 0: 1
1: 1
2: 3
3: 53
4: 753
Right 942034738 2:171999874-171999896 GCCTCGACGCCTCAGGGCTTCGG 0: 1
1: 0
2: 2
3: 8
4: 126
942034728_942034738 8 Left 942034728 2:171999843-171999865 CCCGCGCGCGCACGCGCGCTCCC 0: 1
1: 0
2: 5
3: 49
4: 342
Right 942034738 2:171999874-171999896 GCCTCGACGCCTCAGGGCTTCGG 0: 1
1: 0
2: 2
3: 8
4: 126
942034725_942034738 20 Left 942034725 2:171999831-171999853 CCCGCAGTCAGCCCCGCGCGCGC 0: 1
1: 0
2: 1
3: 18
4: 133
Right 942034738 2:171999874-171999896 GCCTCGACGCCTCAGGGCTTCGG 0: 1
1: 0
2: 2
3: 8
4: 126
942034726_942034738 19 Left 942034726 2:171999832-171999854 CCGCAGTCAGCCCCGCGCGCGCA 0: 1
1: 0
2: 0
3: 8
4: 136
Right 942034738 2:171999874-171999896 GCCTCGACGCCTCAGGGCTTCGG 0: 1
1: 0
2: 2
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942034738 Original CRISPR GCCTCGACGCCTCAGGGCTT CGG Exonic