ID: 942035300

View in Genome Browser
Species Human (GRCh38)
Location 2:172004619-172004641
Sequence TTATAAGTTGGTTTGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942035300_942035308 12 Left 942035300 2:172004619-172004641 CCAGCCGCCAAACCAACTTATAA No data
Right 942035308 2:172004654-172004676 GATGCAATTCATGGGTGATTTGG No data
942035300_942035307 4 Left 942035300 2:172004619-172004641 CCAGCCGCCAAACCAACTTATAA No data
Right 942035307 2:172004646-172004668 ACTTTTGGGATGCAATTCATGGG No data
942035300_942035305 -10 Left 942035300 2:172004619-172004641 CCAGCCGCCAAACCAACTTATAA No data
Right 942035305 2:172004632-172004654 CAACTTATAATTAAACTTTTGGG No data
942035300_942035306 3 Left 942035300 2:172004619-172004641 CCAGCCGCCAAACCAACTTATAA No data
Right 942035306 2:172004645-172004667 AACTTTTGGGATGCAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942035300 Original CRISPR TTATAAGTTGGTTTGGCGGC TGG (reversed) Intronic
No off target data available for this crispr