ID: 942040444

View in Genome Browser
Species Human (GRCh38)
Location 2:172056539-172056561
Sequence CAGTGGTGAATGAGGTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942040444_942040447 -1 Left 942040444 2:172056539-172056561 CCTTGTCACCTCATTCACCACTG No data
Right 942040447 2:172056561-172056583 GAATTCTCTAATCCAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942040444 Original CRISPR CAGTGGTGAATGAGGTGACA AGG (reversed) Intronic
No off target data available for this crispr