ID: 942040447

View in Genome Browser
Species Human (GRCh38)
Location 2:172056561-172056583
Sequence GAATTCTCTAATCCAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942040442_942040447 14 Left 942040442 2:172056524-172056546 CCCTGGGAGTCGGGACCTTGTCA No data
Right 942040447 2:172056561-172056583 GAATTCTCTAATCCAGAGCATGG No data
942040445_942040447 -9 Left 942040445 2:172056547-172056569 CCTCATTCACCACTGAATTCTCT No data
Right 942040447 2:172056561-172056583 GAATTCTCTAATCCAGAGCATGG No data
942040444_942040447 -1 Left 942040444 2:172056539-172056561 CCTTGTCACCTCATTCACCACTG No data
Right 942040447 2:172056561-172056583 GAATTCTCTAATCCAGAGCATGG No data
942040443_942040447 13 Left 942040443 2:172056525-172056547 CCTGGGAGTCGGGACCTTGTCAC No data
Right 942040447 2:172056561-172056583 GAATTCTCTAATCCAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942040447 Original CRISPR GAATTCTCTAATCCAGAGCA TGG Intronic
No off target data available for this crispr