ID: 942043502

View in Genome Browser
Species Human (GRCh38)
Location 2:172085962-172085984
Sequence CCTCCAGGCGGCTCTGGGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 321}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942043502_942043514 8 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043514 2:172085993-172086015 ACGTGCGCTTGCCAGGGAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 104
942043502_942043519 26 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043519 2:172086011-172086033 GAGGGAGAGGAGGAGGTACAAGG 0: 1
1: 2
2: 40
3: 407
4: 4503
942043502_942043520 27 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043520 2:172086012-172086034 AGGGAGAGGAGGAGGTACAAGGG 0: 1
1: 1
2: 13
3: 155
4: 1333
942043502_942043510 1 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043510 2:172085986-172086008 CCCAGGTACGTGCGCTTGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 56
942043502_942043513 7 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043513 2:172085992-172086014 TACGTGCGCTTGCCAGGGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 52
942043502_942043516 16 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043516 2:172086001-172086023 TTGCCAGGGAGAGGGAGAGGAGG 0: 1
1: 1
2: 19
3: 143
4: 1317
942043502_942043512 2 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043512 2:172085987-172086009 CCAGGTACGTGCGCTTGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 41
942043502_942043515 13 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043515 2:172085998-172086020 CGCTTGCCAGGGAGAGGGAGAGG 0: 1
1: 0
2: 5
3: 31
4: 395
942043502_942043518 19 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043518 2:172086004-172086026 CCAGGGAGAGGGAGAGGAGGAGG 0: 2
1: 5
2: 48
3: 555
4: 5586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942043502 Original CRISPR CCTCCAGGCGGCTCTGGGCG AGG (reversed) Exonic