ID: 942043502

View in Genome Browser
Species Human (GRCh38)
Location 2:172085962-172085984
Sequence CCTCCAGGCGGCTCTGGGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 321}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942043502_942043510 1 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043510 2:172085986-172086008 CCCAGGTACGTGCGCTTGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 56
942043502_942043515 13 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043515 2:172085998-172086020 CGCTTGCCAGGGAGAGGGAGAGG 0: 1
1: 0
2: 5
3: 31
4: 395
942043502_942043518 19 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043518 2:172086004-172086026 CCAGGGAGAGGGAGAGGAGGAGG 0: 2
1: 5
2: 48
3: 555
4: 5586
942043502_942043519 26 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043519 2:172086011-172086033 GAGGGAGAGGAGGAGGTACAAGG 0: 1
1: 2
2: 40
3: 407
4: 4503
942043502_942043513 7 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043513 2:172085992-172086014 TACGTGCGCTTGCCAGGGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 52
942043502_942043520 27 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043520 2:172086012-172086034 AGGGAGAGGAGGAGGTACAAGGG 0: 1
1: 1
2: 13
3: 155
4: 1333
942043502_942043514 8 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043514 2:172085993-172086015 ACGTGCGCTTGCCAGGGAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 104
942043502_942043516 16 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043516 2:172086001-172086023 TTGCCAGGGAGAGGGAGAGGAGG 0: 1
1: 1
2: 19
3: 143
4: 1317
942043502_942043512 2 Left 942043502 2:172085962-172085984 CCTCGCCCAGAGCCGCCTGGAGG 0: 1
1: 0
2: 2
3: 29
4: 321
Right 942043512 2:172085987-172086009 CCAGGTACGTGCGCTTGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942043502 Original CRISPR CCTCCAGGCGGCTCTGGGCG AGG (reversed) Exonic
900000993 1:14814-14836 CCTCCAGGCATCTCTGGGAAAGG - Intergenic
900020708 1:185335-185357 CCTCCAGGCATCTCTGGGAAAGG - Intergenic
900092838 1:927886-927908 CCTCCAGGTGCCTTGGGGCGTGG + Intronic
900109158 1:998383-998405 CCTCCAGGCGTCTGTGCGGGGGG - Intergenic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900421293 1:2557044-2557066 TCTCTGGGCGTCTCTGGGCGGGG + Intronic
900438267 1:2641496-2641518 CCTCCAGGCAGCACTGCCCGCGG + Exonic
901025807 1:6278182-6278204 GCTCCAGGAGGCTCTGGGGAGGG + Intronic
901631706 1:10651287-10651309 CCTCCAGGAGGCCCTGAGCCAGG - Intronic
901644376 1:10708849-10708871 CCTGCAGGCGGCTCGGAGTGGGG + Intronic
901664738 1:10819807-10819829 CTTCCAGGGGGCACTGGGAGGGG + Intergenic
904005646 1:27361796-27361818 CCTCCAGGGGGCTCTGGCGTGGG + Exonic
904270878 1:29349334-29349356 CCTCCAGGAGGCTGTTGGGGTGG + Intergenic
904296491 1:29522554-29522576 CCTCCTTGTGGCTCTGGGCTGGG + Intergenic
904312350 1:29637018-29637040 CCTCCTGGAGGCTCTGAGGGAGG + Intergenic
904425418 1:30419612-30419634 CCTCCAGGAGGCTCTCAGGGTGG - Intergenic
907414812 1:54307024-54307046 CCTCCTGGAGGCTGTGGGCAGGG - Intronic
908029132 1:59981494-59981516 CCTCCAGGTGGCCCAGGGTGGGG + Intergenic
910935943 1:92484721-92484743 GCTCCAGCCGGCTCCGGGGGCGG + Intronic
912576143 1:110674568-110674590 CCTCAAGGCGGCTGTGGCGGCGG - Exonic
913644605 1:120844599-120844621 CCCCCAGGCGGCTCGGGCCGGGG - Intergenic
913968625 1:143397102-143397124 CCTCCAGGTGGCTCTGCCCTCGG + Intergenic
914063004 1:144222701-144222723 CCTCCAGGTGGCTCTGCCCTCGG + Intergenic
914082131 1:144418984-144419006 CCCCCAGGCGGCTCGGGCCGGGG + Intergenic
914095319 1:144539961-144539983 CCCCCAGGCGGCTCAGGTCCGGG - Intergenic
914098974 1:144567847-144567869 CCCCCAGGCGGTTCGGGCCGGGG - Intergenic
914116146 1:144743653-144743675 CCTCCAGGTGGCTCTGCCCTCGG - Intergenic
914177034 1:145287484-145287506 CCCCCAGGCGGCTCGGGCCGGGG + Intergenic
914300011 1:146369819-146369841 CCCCCAGGCGGCTCGGGCCGGGG + Intergenic
914303207 1:146393935-146393957 CCCCCAGGCGGCTCAGGTCCGGG + Intergenic
914509354 1:148317683-148317705 CCCCCAGGCGGCTCGGGCCCGGG - Intergenic
914531762 1:148528976-148528998 CCCCCAGGCGGCTCGGGCCGGGG + Intergenic
914636630 1:149558753-149558775 CCCCCAGGCGGCTTGGGCCGCGG - Intergenic
915595993 1:156896777-156896799 CCTCCAGGTGACTCAGGGCCTGG + Intronic
917329755 1:173868696-173868718 GCTCCAGGCGGCGGCGGGCGGGG - Intronic
921155032 1:212432841-212432863 CCTCGGGGAGGCTCTGGGCGCGG + Intergenic
921259687 1:213374832-213374854 CCTCCAGAGGCCTCTGGGAGGGG + Intergenic
922817868 1:228463843-228463865 CCGCCAGGAGGCACTGGGGGCGG + Intergenic
923605337 1:235438174-235438196 CCTCCAGGCAGACCTGGGGGAGG + Intronic
924598189 1:245465295-245465317 CCTCCAGCCGCCTGTGGGTGGGG + Intronic
1063592804 10:7409148-7409170 CCTCCACGCCGCTCTGGGGTGGG - Intronic
1064552967 10:16521110-16521132 CCACCAGCCGGCTCAGCGCGGGG + Exonic
1069710773 10:70487049-70487071 GCTCCAGGGGGCTCTGAGCTGGG + Intronic
1069859167 10:71459798-71459820 CCTCCAGGGAGCTCTGGGGCTGG - Intronic
1070407777 10:76112245-76112267 CTGCCAGGAGGCTCTGGGTGGGG + Intronic
1070795606 10:79214656-79214678 CCTCCAGGCGCCTCTGGAGCAGG + Intronic
1072881999 10:99236882-99236904 CCTCCAGGAGGGTCTGGAGGGGG - Intergenic
1073143285 10:101262818-101262840 CATCCAGCCTGCTCTGGGGGAGG - Intergenic
1073240692 10:102055986-102056008 CCCCGAGGCGGTTCTGGGGGCGG - Intronic
1073249711 10:102114293-102114315 CGCCCCGGCGGCTCTGGGCTGGG + Intronic
1073288535 10:102402317-102402339 CCTCCTGGTGGCTCAGGGGGTGG - Exonic
1073563848 10:104519015-104519037 CCTCCTCGCTGCTCTGGGAGGGG + Intergenic
1075302527 10:121338187-121338209 CCTGAAGGGGGTTCTGGGCGTGG - Intergenic
1075670708 10:124262495-124262517 CATCCAGGAGGCCCTGGGCAGGG - Intergenic
1075871536 10:125774967-125774989 CCTCCACGCGGCTGCGGGCCTGG + Intronic
1076347292 10:129788247-129788269 CCTCCAGCCAGCTCTGGGCAAGG + Intergenic
1076724029 10:132405087-132405109 CCTCCTGCGGGCCCTGGGCGCGG - Exonic
1076922231 10:133460001-133460023 CCCCCAGGGCGCTCAGGGCGCGG - Intergenic
1077014642 11:394167-394189 TCTTCAGGCGGCTCTGGGTGAGG + Intronic
1077065598 11:639792-639814 CCTCCAGGCGGCACACGGCGGGG - Exonic
1077081424 11:726200-726222 CCCCCAGGTGGCCCTGGGCCCGG - Intronic
1077175475 11:1187958-1187980 CCTCCGGGTGGCTCTCGGCTCGG - Intronic
1077175633 11:1188852-1188874 CCTCCGGGTGGCTCTTGGCTCGG - Intronic
1077175863 11:1190151-1190173 CCTCCGGGTGGCTCTCGGCTCGG - Intronic
1077176227 11:1192173-1192195 CCTCCGGGTGGCTCTCGGCTCGG - Intronic
1077546296 11:3171619-3171641 CCTTCTGGAGGCTCTGGGGGAGG + Intergenic
1077903606 11:6511342-6511364 CCTGCAGACGGCTCTAGCCGAGG + Exonic
1078460597 11:11512335-11512357 CCTCCTGGCGGATCTGGGTCAGG - Intronic
1083303751 11:61752534-61752556 CCGGCAGGGGGCGCTGGGCGCGG + Intergenic
1083330987 11:61898271-61898293 CCCCCAGGAGGCTTAGGGCGCGG - Exonic
1083827665 11:65212386-65212408 CCTGAAGGCGGCTCTGTGCTCGG - Intergenic
1083883301 11:65558631-65558653 CCTCCGGGCGGGGCGGGGCGGGG + Intronic
1084406870 11:68979339-68979361 CCTCCAGGCCGCACTGGGAAGGG - Intergenic
1084757924 11:71251282-71251304 CCTCCAGGCGGGTCTGCGTGCGG - Intronic
1085417682 11:76330132-76330154 CCTGCAGGGAGCTCTGGGGGTGG + Intergenic
1089139872 11:116276540-116276562 CCTCCAGGCCGCTGTCGGTGTGG - Intergenic
1089181510 11:116586478-116586500 CATCCAGTGGTCTCTGGGCGTGG - Intergenic
1090954019 11:131498756-131498778 CCTCCTGGCAGCTTTGGGCCTGG - Intronic
1091374082 12:14929-14951 CCTCCAGGCATCTCTGGGAAAGG - Intergenic
1091915419 12:4269491-4269513 CCTCCAGGCGCCCCCGGGAGGGG - Intergenic
1096003501 12:48149321-48149343 CGTGCAGGCAGCTCTGGGTGAGG - Exonic
1096499159 12:52054931-52054953 ACTTCAGGGGGCTCTGGGCCAGG - Exonic
1097104810 12:56615764-56615786 CATCCAGGAGCCTCTGGGCTTGG - Intronic
1097250122 12:57627879-57627901 CCTCCAGGCGGGCCTGGGATAGG + Intronic
1100431377 12:94534418-94534440 CCTCCTGGAGGCTCTGGGGGAGG - Intergenic
1102882593 12:116497296-116497318 CCTCCAGATATCTCTGGGCGTGG + Intergenic
1103220363 12:119239290-119239312 CCTCTAGGGGGCTGTGGGCTGGG - Intergenic
1103395086 12:120601062-120601084 CCTGCAGGCGGCCCTGGCAGAGG - Intergenic
1103703807 12:122860936-122860958 CCTGCAGGCGGCTCAGGTGGGGG - Exonic
1103779678 12:123389946-123389968 ACTGCGGGCGCCTCTGGGCGTGG - Intronic
1104846527 12:131849992-131850014 TCCACAGGGGGCTCTGGGCGGGG - Exonic
1105303722 13:19155347-19155369 CCTCCAGGCGGCTGGTGGAGTGG + Intergenic
1105544998 13:21344753-21344775 CCTCCAGGGGCCTCTGGCCCAGG + Intergenic
1106127365 13:26911375-26911397 CCTCCAGTTGGCTCTGTGCTGGG - Intergenic
1108356196 13:49630650-49630672 CTTCCAGCTGGCTCTGAGCGGGG - Exonic
1113438081 13:110308102-110308124 CCGCCAAGACGCTCTGGGCGAGG - Exonic
1114187367 14:20413207-20413229 CCTCCCGGCGGCTCCGGGAAGGG - Intronic
1114655137 14:24311305-24311327 GCTCCGGGCGGCACGGGGCGCGG + Exonic
1119424490 14:74526932-74526954 CCTCCAGGTCCCTCTGGGAGTGG - Intronic
1119695349 14:76709063-76709085 CCACCACGAGGCTCTGGGTGGGG + Intergenic
1121533027 14:94671861-94671883 CCTCCAGGCCTCTCTGGGGCTGG - Intergenic
1122078112 14:99248421-99248443 CCCCCAGCAGGCTCTGGGCCAGG + Intronic
1122627435 14:103091590-103091612 CCGCCCGCGGGCTCTGGGCGTGG - Intergenic
1122688672 14:103521629-103521651 GCCCCAGGCCGCTGTGGGCGCGG + Intronic
1123112245 14:105878405-105878427 GCTGCAGGCAGCTCTGGGGGTGG - Intergenic
1123699270 15:22902657-22902679 CCTCCAGGCCGGGCTGGGAGTGG - Intronic
1125500763 15:40239224-40239246 CTGCCAGGCAGCCCTGGGCGCGG + Intronic
1126348033 15:47717296-47717318 CCTCCAGGCGGCGCTGGCCACGG + Intronic
1128706025 15:69837915-69837937 CCTCCTGTCAGCTCTGGGCCAGG + Intergenic
1129391805 15:75224472-75224494 ACTCAGGCCGGCTCTGGGCGTGG - Intergenic
1130107850 15:80942456-80942478 CCTCCAGGGGGCTTGGGGCGGGG + Intronic
1130417319 15:83705804-83705826 CCTCCAGACCGCTGTGGGCAGGG + Intronic
1130653108 15:85773497-85773519 CCTCCAGGCAGCTCAGCGGGTGG + Intronic
1132365667 15:101254539-101254561 CCTCCAGGGGGCTGTGGGGAAGG - Intergenic
1132452516 15:101976126-101976148 CCTCCAGGCATCTCTGGGAAAGG + Intergenic
1132454381 16:14496-14518 CCTCCAGGCATCTCTGGGAAAGG - Exonic
1132481074 16:166358-166380 CATGCTGGCGGCTGTGGGCGCGG + Exonic
1132669747 16:1097751-1097773 CCTCCACCCTGCTCTGTGCGTGG - Intergenic
1132708700 16:1257144-1257166 CCTCAGGGCGGCTCAGGGAGGGG + Intronic
1132973279 16:2699268-2699290 CCTCCAGGCAGCTGTGGTCCTGG - Intronic
1133234045 16:4379451-4379473 CCTCCAGATGGCCCTGGGGGCGG - Intronic
1134457500 16:14405747-14405769 CCTCCGGCCGGCTGGGGGCGGGG - Intergenic
1136318353 16:29466872-29466894 AGTCAAGGCGGCTCCGGGCGGGG - Exonic
1136432928 16:30206221-30206243 AGTCAAGGCGGCTCCGGGCGGGG - Exonic
1138266137 16:55661000-55661022 GCTGCAGGAGGCTCTGGGAGGGG + Intronic
1138588928 16:57988884-57988906 ACTCCAGGCGGCTCTGCCAGTGG - Intergenic
1139846478 16:69924919-69924941 CAGCCAGGAAGCTCTGGGCGTGG + Intronic
1141662469 16:85448835-85448857 TCTCCAGGAGGCCCTGGGAGAGG - Intergenic
1141790729 16:86232477-86232499 GCTCCTGGGAGCTCTGGGCGAGG - Intergenic
1141955090 16:87365475-87365497 GAGCCAGGCCGCTCTGGGCGTGG + Intronic
1142602250 17:1059353-1059375 TCTCCACGTGGCCCTGGGCGGGG + Intronic
1142631492 17:1229177-1229199 CCCCCAGGCGGCTCCCGGCACGG - Intergenic
1142644050 17:1300750-1300772 CCTCCAGGCGGCGTGGGGCACGG - Exonic
1143044108 17:4062865-4062887 CTTCCAGGATGCTCTGGGCCTGG + Exonic
1143449675 17:7028433-7028455 CCTCCTGGAGGCTGTGGGTGTGG + Exonic
1143724360 17:8835308-8835330 CCTGCAGGCGGCTCTGGGGGAGG - Exonic
1143749965 17:9021179-9021201 TCTCCGGGCGGCGCGGGGCGCGG + Intergenic
1144197335 17:12907115-12907137 ACACCAGGAGGCTCTGGGCTGGG + Intronic
1144837371 17:18163735-18163757 CCCCCAGGTGGCCCTGGACGTGG + Exonic
1146260034 17:31415074-31415096 TCTGCAGGGGGCTCTGGGAGAGG - Intronic
1147462400 17:40581752-40581774 CCTCCAGGGGACTCTGGGTCTGG - Intergenic
1147664243 17:42135977-42135999 CCTGCAGGGGACCCTGGGCGGGG - Intronic
1147759277 17:42787271-42787293 ATTCCAGGTGGCTCTGGGCTTGG + Exonic
1147836259 17:43334174-43334196 CCTCCAGATGGCTGTGGGCATGG + Intergenic
1150250082 17:63700206-63700228 CCCGAAGGCGGCTCCGGGCGCGG - Intronic
1151124570 17:71831104-71831126 CCACCAGGCGGCTCTCAGCCCGG - Intergenic
1151367872 17:73628912-73628934 CGTCCAGGGGGGTCTGGGCATGG - Intronic
1151724045 17:75874605-75874627 TGTCCAGGCGGCTCTGGAAGGGG + Exonic
1151913959 17:77103866-77103888 GATCCAGGCGGCACCGGGCGGGG + Intronic
1152219057 17:79050933-79050955 CCTCCAGGCACCTCTGGGAAGGG - Intergenic
1152280837 17:79384102-79384124 CCTACAGCGGGCTCAGGGCGAGG + Intronic
1152633932 17:81422859-81422881 ACTCGAGGCGGGCCTGGGCGAGG + Intronic
1152643853 17:81459989-81460011 CCTCCAGGCGGGACTCGGCTGGG + Intronic
1153006181 18:500471-500493 GCTCCGCGGGGCTCTGGGCGGGG - Intronic
1153050872 18:902041-902063 CCCCCAGGCTGCTGTGGGCAGGG + Intergenic
1154176863 18:12091705-12091727 CCTCCTGGTGGCTCAGGGGGTGG + Intergenic
1157674968 18:49562072-49562094 CCTCCCGGCGGCTCAGGACGAGG + Exonic
1158513837 18:58114736-58114758 CCTCCCGGAGGCTCTAGGAGAGG + Intronic
1160491289 18:79338268-79338290 CGTCCAGGCGTCTCTGGGGCAGG - Intronic
1160772748 19:840444-840466 CCCCCAGGGGACCCTGGGCGAGG - Intergenic
1160797432 19:952546-952568 CCTCCTGGAGGCTCAGGGCTCGG + Intronic
1160968142 19:1755515-1755537 CCTCCGGGCGGCGCGGGCCGAGG - Intronic
1160981550 19:1818747-1818769 CCCCCGGGCCGCTCTGGGTGCGG + Exonic
1161229073 19:3163426-3163448 CCTTCAGGCGCCTTCGGGCGTGG + Exonic
1161253393 19:3293447-3293469 CCTCAGGGCGGCTGTGGGCGCGG - Exonic
1161393526 19:4033225-4033247 CCCCCTGGCGGCCCTGGGCCCGG + Intronic
1161644691 19:5445811-5445833 CCTCCAGTGGCCTCTGGGAGTGG + Intergenic
1161950178 19:7463518-7463540 CCACCAGGCCGCCCTGGGCCAGG - Intronic
1162372994 19:10290085-10290107 CCTCTGGGCTGCTCTGGGCCTGG + Exonic
1162567837 19:11454011-11454033 CCACCAGGGGGCACTGGGCCGGG + Exonic
1162706054 19:12555587-12555609 CCTCCAGGTGGCTGCGGGAGCGG + Intronic
1163598622 19:18234595-18234617 CCTCCTGTGGGCTCTGGGCTTGG + Intronic
1163687642 19:18721008-18721030 CCTGCAGGAGGCTCTAGGGGAGG + Intronic
1163710050 19:18841001-18841023 GCTCCTGGCGGCCCTGGGAGAGG + Intronic
1163719792 19:18893697-18893719 GCTCCAGGTGGCTGTGGGCATGG - Intronic
1165316584 19:35059961-35059983 CCTCCAGCAGCCTCTGGGTGTGG - Exonic
1167116674 19:47492701-47492723 CCTCCAGGAAGCTCTGCGAGGGG + Intronic
1167333954 19:48873323-48873345 CCCTCAGGCGGCTCCAGGCGCGG - Exonic
1167509911 19:49890600-49890622 CCTGCAGGCGGGGCGGGGCGGGG + Exonic
1202702414 1_KI270712v1_random:174572-174594 CCTCCAGGTGGCTCTGCCCTCGG + Intergenic
929175264 2:38969343-38969365 CCTCCAGAGGGCTGTGGGGGAGG - Intronic
929188592 2:39120428-39120450 CCCCGGGGCGCCTCTGGGCGGGG + Exonic
931430655 2:62206233-62206255 CCTCCATGCAGCTCTGGGCTGGG + Intronic
931670145 2:64640402-64640424 CCTCCAGGCCTTTCTGGGCCTGG + Intronic
934173326 2:89558026-89558048 CCTCCAGGTGGCTCTGCCCTCGG + Intergenic
934283641 2:91632379-91632401 CCTCCAGGTGGCTCTGCCCTCGG + Intergenic
934296877 2:91749191-91749213 GCCCCAGGCGGCCCGGGGCGAGG + Intergenic
934522939 2:95031283-95031305 CCACCTGGCAGCTCTGGGCAAGG + Intronic
935406859 2:102718632-102718654 CCTCCAGCTGACTGTGGGCGGGG - Exonic
935786429 2:106552883-106552905 CTACCAGGAGGCTTTGGGCGAGG - Intergenic
936012426 2:108933544-108933566 CCTCCAGGTGGCTTTGGGGAAGG + Intronic
936144414 2:109970223-109970245 GCTCCAGATGGCTGTGGGCGGGG - Intergenic
936181096 2:110268183-110268205 GCTCCAGATGGCTGTGGGCGGGG - Intergenic
936200274 2:110401246-110401268 GCTCCAGATGGCTGTGGGCGGGG + Intergenic
936462292 2:112722442-112722464 CCTCCAGGAGGCACTGGGGAGGG + Intronic
936568728 2:113598600-113598622 CCTCCAGGCATCTCTGGGAAAGG + Intergenic
938292440 2:130157261-130157283 CCTCCAGGGGGCTGGTGGCGTGG + Exonic
938464114 2:131515715-131515737 CCTCCAGGGGGCTGGTGGCGTGG - Intergenic
941508427 2:166376085-166376107 CCTGCGGGCGGCGCAGGGCGGGG + Intergenic
942043502 2:172085962-172085984 CCTCCAGGCGGCTCTGGGCGAGG - Exonic
947811107 2:233004436-233004458 ACTCCAGGCTGATCTGGGCTAGG + Intronic
948389197 2:237599935-237599957 TCTCCAGGCTGCTCGGGGCAGGG - Intronic
948457696 2:238114465-238114487 GCTCCCGGAGGCTCTGGGCTGGG - Intronic
948645295 2:239400619-239400641 CCTGCAGGCTGCGCGGGGCGCGG + Exonic
948903501 2:240967410-240967432 GCCCCACGCGGCTCTGGGCCCGG - Intronic
1170325456 20:15151149-15151171 GTTCCAGGGGGCTCTGGGAGTGG + Intronic
1172118731 20:32585524-32585546 CCTCCCGGCGGCTGCGGGCGCGG - Intronic
1172581239 20:36050598-36050620 CCTTTGGGCGGCGCTGGGCGTGG - Intergenic
1172974212 20:38894282-38894304 GCCCCAGGTGGCTGTGGGCGTGG - Intronic
1173853243 20:46232247-46232269 CCCCCAGCTGGCTCTGGGAGTGG + Intronic
1174101487 20:48129513-48129535 CCCCCAGGTGGCCATGGGCGTGG + Intergenic
1175936363 20:62515966-62515988 CCTCAAGGCAGCCCTGGGTGCGG + Intergenic
1175961286 20:62637865-62637887 CCTCCCCGCGGGTCTGGGGGTGG - Intergenic
1176005556 20:62860892-62860914 CCTCCCGGCGGCACAGGGCGCGG - Intronic
1177250371 21:18583988-18584010 GCTCCAGGCGGCACAGGGTGGGG - Intergenic
1177775521 21:25562152-25562174 GCTGCAGGCGGCGCTGGGCCCGG - Intergenic
1178947601 21:36960810-36960832 CCTCCAGGAGCCTCAGGGCATGG + Intronic
1179248232 21:39651380-39651402 CCTCCCGCAGGCTCTGGGAGTGG + Intronic
1179645314 21:42771747-42771769 GCTCCAGGCGGGTGTGGGCATGG - Intronic
1180149365 21:45939863-45939885 CCTGCAGGCAGGTGTGGGCGGGG + Intronic
1181627965 22:24134142-24134164 GCTCCAGGCTGCTCTGGCCATGG - Intronic
1183560708 22:38570365-38570387 CCTGGAGGGGGCTCAGGGCGAGG + Intergenic
1183739534 22:39662290-39662312 CCTCCAGGCGGCCCGGGGGTGGG - Exonic
1184080107 22:42213327-42213349 CCTCCTGGAGGCTCTGGCTGGGG + Exonic
1184166614 22:42732885-42732907 CCTCCATTTGGGTCTGGGCGCGG + Intergenic
1184595123 22:45509277-45509299 CCTCCAGGCAGCTCTGGCCCCGG - Intronic
1184680437 22:46070143-46070165 GCTCCATGCGGCTCTGGGCCAGG + Intronic
1185241717 22:49750533-49750555 CCTCCTGGCCGCACTGGGCCTGG - Intergenic
950008157 3:9704514-9704536 CCTCGAGTCGGCTCTGAGCCGGG - Intronic
950316373 3:12004865-12004887 CTTCCTGGCGGCTGCGGGCGCGG - Exonic
950362394 3:12458954-12458976 CCATCAGGCGCCTCTGGGCCGGG + Intergenic
950456237 3:13094385-13094407 CTTCCAGGTGGCTCCGGGAGAGG - Intergenic
950864190 3:16175655-16175677 CCTCCAGAGGGCTCTGCCCGAGG + Exonic
952178645 3:30894627-30894649 ACTCCAGGCTGCCCCGGGCGCGG + Exonic
952942564 3:38455056-38455078 CCTCCAGGAGGCACGTGGCGGGG + Intronic
956049774 3:65235410-65235432 CCTCCAGACTGGGCTGGGCGTGG + Intergenic
960664443 3:120095421-120095443 CCCACAGGAGGCTCTCGGCGGGG + Intergenic
961565832 3:127762775-127762797 CCTGCATGCTGCTCTGGGCCAGG + Intronic
961838374 3:129684442-129684464 CCTCCAGGTGGCACTAGGCCTGG + Intronic
968286236 3:197510395-197510417 CCTCCAGGGGGCTTTCGGCCCGG - Exonic
968472466 4:788321-788343 GCTGCAGGTGGCTCTGGGTGTGG + Intronic
968589237 4:1449499-1449521 CCTGCAGGCTGATCTGGGCTGGG + Intergenic
969072329 4:4549445-4549467 CCTCCAAGTAGCTCTGGGAGTGG - Intergenic
969085533 4:4653354-4653376 CCTCCAGGGGGCTCTGAGGGAGG - Intergenic
969252716 4:5980206-5980228 CCACCAGGCGTCTCTGGACGAGG - Exonic
969297132 4:6276805-6276827 CCTCCTGGAGGCTCTGAGGGAGG + Intronic
969627961 4:8317236-8317258 CCTCCAGCAGGCCCTGGGTGAGG + Intergenic
972353605 4:38260074-38260096 CTGCCAGGCGGCTCTGGCTGTGG + Intergenic
973661958 4:53117253-53117275 ACTCCAAGCTGCTCTGGGCCAGG - Intronic
975848908 4:78551892-78551914 TCAGCAGGCGGCTGTGGGCGAGG - Intronic
979582768 4:122379544-122379566 GCTTCAGGCCGCTCTGCGCGAGG - Intronic
985632624 5:1021938-1021960 GCTGCAGGCGGCCCTGGGGGAGG - Intronic
985716640 5:1466815-1466837 CCTCAAGACGGCCCTGGGGGTGG - Exonic
991054581 5:62306796-62306818 TCTCCGGGGGTCTCTGGGCGAGG + Intronic
992106361 5:73451691-73451713 CCTCCAGGAGCCCCTGCGCGGGG + Intergenic
996298527 5:121954069-121954091 CCTCCCTGCGGGTCAGGGCGCGG - Intergenic
996885660 5:128350893-128350915 CCCCCAGGCGGCTCCGAGGGTGG + Exonic
997378896 5:133421167-133421189 CCACCAGGCATCTCAGGGCGGGG + Intronic
998230906 5:140360944-140360966 GCTCCAGGAGGCTCTGAGCTGGG - Exonic
999217103 5:149944505-149944527 CCTCCATGCTGCTCGGGGAGTGG + Exonic
1000210131 5:159100696-159100718 CCTCCAGCGCGCTCAGGGCGCGG - Intergenic
1002047637 5:176550763-176550785 CCTCCAGGAGGGTCAGGGTGGGG - Intronic
1002175785 5:177400378-177400400 CCTGCAGGCGGGCCTGAGCGTGG - Exonic
1002488941 5:179560095-179560117 GCTCCAGTCGGCTCTGAGCCTGG + Exonic
1003406621 6:5831751-5831773 CCTCCAGGGGCCTCTGGCCCAGG - Intergenic
1006301927 6:33198346-33198368 CCTCCAGGTGGCCCTGGGGCTGG - Exonic
1008378773 6:50820269-50820291 CTTCGAGGCGGCTCTGCGCCGGG - Intronic
1015366384 6:132401575-132401597 CCTGCAGGCGGCCCGGGGCGGGG - Intergenic
1015773619 6:136792579-136792601 CGTCCCGGCCGCTCTGGGAGGGG + Intergenic
1018641444 6:165907785-165907807 CACCCATGCTGCTCTGGGCGCGG - Intronic
1019271925 7:154283-154305 CGTCCAGGCTGCTCTCGGGGAGG - Intergenic
1019381538 7:726804-726826 GCAGCAGGCGGCTCAGGGCGCGG - Exonic
1024317672 7:48036140-48036162 CCTGCAGGCGTGTCAGGGCGAGG + Intronic
1026897982 7:74021602-74021624 CCTGCAGGCGGCTGTGTGGGTGG + Intergenic
1027001587 7:74658033-74658055 CCTCCAGGCAGCTCCGGGGCCGG - Exonic
1027361518 7:77415610-77415632 CCTCCAGGCTGCGCGCGGCGGGG - Intronic
1029446133 7:100613649-100613671 CCAGCAGGAGGCCCTGGGCGAGG - Exonic
1029460901 7:100693684-100693706 CCCCCAGGCGGCCCAGGGCAGGG + Intergenic
1030042464 7:105464468-105464490 CCTCCAGTCGGCTGGGGGCCTGG + Intronic
1032457276 7:132082995-132083017 GCTCCATGCGGCTCCGTGCGTGG + Intergenic
1033814676 7:145057433-145057455 CCTTCTGGAGGCTCTGGGGGAGG + Intergenic
1034492216 7:151399468-151399490 CCTCCTGGCGCCCCTGGGCCTGG - Intronic
1034816381 7:154175468-154175490 CTTCCTGGAGGCTCTGGGGGTGG - Intronic
1034969613 7:155410863-155410885 CCTTCTGGAGGCTCTGGGAGGGG + Intergenic
1035270825 7:157719007-157719029 CCTGCAGGCGTCTCTGGCCCTGG + Intronic
1035385999 7:158473402-158473424 CCTCCCGGCTGTCCTGGGCGTGG - Intronic
1036453633 8:8890967-8890989 CCTGCAGGCGGGTCTGACCGAGG - Exonic
1037083582 8:14817968-14817990 CCTGCAGGCATATCTGGGCGAGG - Intronic
1037816300 8:22114556-22114578 CCACCAGGAGGCTGCGGGCGTGG + Exonic
1038357896 8:26847302-26847324 CCTCCAGGAGGCACTTGGCAAGG - Intronic
1038455046 8:27667464-27667486 CCTCCAGGCAGTGCTGGGAGTGG + Intronic
1038472745 8:27838969-27838991 CCTCCAGGCTGCTCTGCCTGTGG - Intergenic
1042367381 8:67952564-67952586 CGTCCGGGCGGCGCGGGGCGCGG + Intronic
1043889892 8:85643569-85643591 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043891430 8:85655477-85655499 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043892503 8:85662314-85662336 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043893054 8:85715021-85715043 CCTCCGGGCCGCTCGGGGTGCGG - Intergenic
1043895741 8:85736475-85736497 CCTCCGGGCCGCTCGGGGTGCGG - Intergenic
1043896938 8:85745333-85745355 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043899262 8:85763700-85763722 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043900872 8:85775894-85775916 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043902836 8:85791169-85791191 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043904446 8:85803362-85803384 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043906058 8:85815553-85815575 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1043907666 8:85827743-85827765 CCTCCGGGCCGCTCGGGGTGCGG + Intergenic
1045231428 8:100310226-100310248 GCTGCGGGCGGCTCTGGACGCGG + Intronic
1045328771 8:101137361-101137383 CCTCCAGGCGGCACGGGCCTGGG + Intergenic
1047431616 8:124798189-124798211 CCCCCAGGGGGCTCTGGGGTGGG + Intergenic
1049175465 8:141189826-141189848 GGTGCAGGCGGCTGTGGGCGGGG - Intronic
1049538106 8:143191884-143191906 CTTCCAGGTGGCTCTGAGCTGGG + Intergenic
1049542130 8:143213437-143213459 CATCCATGCTGCTCTGGGCTGGG - Intergenic
1049551421 8:143261684-143261706 CCTGCAGGCCGCTCAGGGCAGGG + Intronic
1049657161 8:143804012-143804034 CATCCAGGCGGTTCTGTGAGAGG - Intronic
1049686902 8:143942704-143942726 CTTCCTGGCTGCGCTGGGCGGGG - Intronic
1049687328 8:143944197-143944219 CCTCCCGGCGGGTGTGGCCGCGG - Intronic
1049883799 9:14925-14947 CCTCCAGGCATCTCTGGGAAAGG - Intergenic
1052835081 9:33244489-33244511 CCTACAGGCAGCTTTGGGCGAGG + Intronic
1053292225 9:36888767-36888789 CCTCCAGGCAGCTCTGCAGGCGG + Intronic
1054174275 9:61864259-61864281 CTTCCAGGCGCCACTCGGCGAGG - Intergenic
1054663263 9:67716532-67716554 CTTCCAGGCGCCACTCGGCGAGG + Intergenic
1054820620 9:69517009-69517031 CCTCCTGGCCGAGCTGGGCGCGG + Exonic
1055620416 9:78119655-78119677 CCTCCTGGAGGCCCTGGGAGAGG - Intergenic
1056711702 9:88996847-88996869 ACTCCAGGAGCCTCAGGGCGGGG + Exonic
1057572865 9:96217670-96217692 CCTCCCGGCGTCTCTGGGCAGGG - Intergenic
1059384088 9:113950656-113950678 CCTCCAGGCTGCCCTCGGCCTGG + Intronic
1059633453 9:116150026-116150048 CCTTCAGGCTGCTCGGGGAGGGG + Intergenic
1060965927 9:127712298-127712320 CCTGGAGGCGGCTCTGGTCCAGG + Exonic
1060985098 9:127815254-127815276 GATCCAGGTGGCTCTGGGCTGGG + Exonic
1061063140 9:128260772-128260794 CCTGCTGGGGGCTCTGGGGGCGG + Exonic
1061182439 9:129032723-129032745 CCCGCTGGCTGCTCTGGGCGTGG - Intergenic
1061484429 9:130913156-130913178 ACTCCAGGCAGCTCTGGCCCGGG - Intronic
1061790347 9:133055811-133055833 TCCCCAGGAGGCTCTGGGAGAGG - Intronic
1061840500 9:133356297-133356319 CCTCCAGGCGGCGCTGGCCGGGG + Exonic
1061843730 9:133375643-133375665 CCTCCAGCCAGCCCGGGGCGCGG - Intronic
1062200923 9:135302170-135302192 CCTCCTGGGGGCTCAGGGCAAGG + Intergenic
1062210258 9:135359813-135359835 CCCTCGGGAGGCTCTGGGCGAGG - Intergenic
1062272173 9:135714570-135714592 CCCGCAGGCGGCCCTGCGCGGGG + Exonic
1062318426 9:135979092-135979114 GCTCCGGGTGGCTCTGGGTGGGG + Intergenic
1062444372 9:136587527-136587549 CCTCCAGGCAGCACAGGGCGAGG + Intergenic
1062446049 9:136595422-136595444 CCTCCAGGGGCTGCTGGGCGAGG - Intergenic
1062500059 9:136848446-136848468 CCTCCAGAGAGCTCTGGGCGCGG - Exonic
1062574340 9:137199550-137199572 CCTCCAGGGGGCTCTTCCCGAGG + Exonic
1062666146 9:137673668-137673690 CCTCAGGGAGGCTCTGGCCGGGG + Intronic
1185536788 X:868889-868911 CCTCCTGGAGGCTCTAGGGGAGG + Intergenic
1186464486 X:9774403-9774425 CCACCAGGCGGCCCTGAGAGTGG - Intronic
1187305274 X:18089623-18089645 CCTCCAGGTTGCACTGGGAGAGG + Intergenic
1190745693 X:53320781-53320803 CCACCAGGCGGCCCGGGACGTGG - Exonic
1192212527 X:69136964-69136986 CCTCCACGCGGCACTGGGGGCGG - Intergenic
1197415004 X:126164772-126164794 CCTCCAGGAACTTCTGGGCGCGG + Exonic
1200068412 X:153515929-153515951 CCCCATGGCGGCTCTGGGCCCGG + Intergenic
1200402012 X:156025234-156025256 CCTCCAGGCATCTCTGGGAAAGG + Intergenic
1200873591 Y:8128576-8128598 CCTCCAGGAGGCTCAGGCCGTGG + Intergenic