ID: 942045069

View in Genome Browser
Species Human (GRCh38)
Location 2:172095286-172095308
Sequence ACTGGGGACCCTCCCCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045051_942045069 18 Left 942045051 2:172095245-172095267 CCGACCCTCGGCCCCCATCTCCT No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045057_942045069 6 Left 942045057 2:172095257-172095279 CCCCATCTCCTAGCCCGGGACCC No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045056_942045069 7 Left 942045056 2:172095256-172095278 CCCCCATCTCCTAGCCCGGGACC No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045063_942045069 -7 Left 942045063 2:172095270-172095292 CCCGGGACCCGACTCGACTGGGG No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045059_942045069 4 Left 942045059 2:172095259-172095281 CCATCTCCTAGCCCGGGACCCGA No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045047_942045069 30 Left 942045047 2:172095233-172095255 CCCACTCGGCACCCGACCCTCGG No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045052_942045069 14 Left 942045052 2:172095249-172095271 CCCTCGGCCCCCATCTCCTAGCC No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045060_942045069 -2 Left 942045060 2:172095265-172095287 CCTAGCCCGGGACCCGACTCGAC No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045065_942045069 -8 Left 942045065 2:172095271-172095293 CCGGGACCCGACTCGACTGGGGA No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045053_942045069 13 Left 942045053 2:172095250-172095272 CCTCGGCCCCCATCTCCTAGCCC No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045050_942045069 19 Left 942045050 2:172095244-172095266 CCCGACCCTCGGCCCCCATCTCC No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045058_942045069 5 Left 942045058 2:172095258-172095280 CCCATCTCCTAGCCCGGGACCCG No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data
942045049_942045069 29 Left 942045049 2:172095234-172095256 CCACTCGGCACCCGACCCTCGGC No data
Right 942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045069 Original CRISPR ACTGGGGACCCTCCCCAAAA GGG Intergenic
No off target data available for this crispr