ID: 942045746

View in Genome Browser
Species Human (GRCh38)
Location 2:172098395-172098417
Sequence TGCGGGCCCTAGCACTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045739_942045746 20 Left 942045739 2:172098352-172098374 CCAAGGTCACACAGTCAGTGATT 0: 1
1: 3
2: 46
3: 396
4: 1859
Right 942045746 2:172098395-172098417 TGCGGGCCCTAGCACTTTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 57
942045743_942045746 -7 Left 942045743 2:172098379-172098401 CCAGGAAGCTTCCAACTGCGGGC 0: 1
1: 0
2: 1
3: 6
4: 71
Right 942045746 2:172098395-172098417 TGCGGGCCCTAGCACTTTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 57
942045737_942045746 22 Left 942045737 2:172098350-172098372 CCCCAAGGTCACACAGTCAGTGA 0: 1
1: 3
2: 25
3: 138
4: 532
Right 942045746 2:172098395-172098417 TGCGGGCCCTAGCACTTTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 57
942045738_942045746 21 Left 942045738 2:172098351-172098373 CCCAAGGTCACACAGTCAGTGAT 0: 1
1: 5
2: 83
3: 548
4: 2078
Right 942045746 2:172098395-172098417 TGCGGGCCCTAGCACTTTCAGGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045746 Original CRISPR TGCGGGCCCTAGCACTTTCA GGG Intergenic
900358261 1:2275107-2275129 TGGGGGCAGTAGCCCTTTCAGGG - Intronic
900930069 1:5730865-5730887 TGGGGGCCCTGGCTCTTTGAGGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
909264350 1:73537511-73537533 TGCTGGCCATAGCACTCTAATGG + Intergenic
910519658 1:88105486-88105508 TGCTGGCCCTAGCACTAGTAAGG - Intergenic
912938212 1:114022094-114022116 TGAGGGCCCTAGTACCTTAAAGG - Intergenic
919487806 1:198165679-198165701 TAAGGGCCCTAGGATTTTCAGGG + Intronic
919633132 1:199978335-199978357 TAAGGACACTAGCACTTTCAGGG - Intergenic
923296379 1:232598614-232598636 TCAGGGCACTAGCACATTCAGGG + Intergenic
1069723780 10:70565004-70565026 TGCTGGCCTTAGCACTAACATGG + Intronic
1075687724 10:124375930-124375952 CGCTGGGCCTAGCACTTTGAGGG - Intergenic
1079325819 11:19491157-19491179 TAAGGGCCCTAGGATTTTCAGGG + Intronic
1081401695 11:42650491-42650513 TGCGGGCTGCAGCACTTTGAGGG + Intergenic
1090066964 11:123511355-123511377 TGCGGGCCCGGGCACCTCCAGGG + Intergenic
1093631430 12:21413918-21413940 TGAGGGCTCCAGTACTTTCAAGG - Intronic
1095364197 12:41382566-41382588 AGAGGGCCCTAGGACTCTCAGGG + Intronic
1100398121 12:94202624-94202646 TGCAGGCCCAGGCACGTTCAGGG + Intronic
1105589700 13:21780246-21780268 TCAGGGCCCTAGGATTTTCAAGG - Intergenic
1108993028 13:56688156-56688178 TGCAGCCCCTATTACTTTCAAGG - Intergenic
1119609917 14:76053018-76053040 TTCTGGCCCTACCACTTTCTAGG + Intronic
1122182412 14:99965848-99965870 TGTGGGCCCCAGTACCTTCAAGG + Intergenic
1127775203 15:62259160-62259182 TGAGGGCCCTGGTACCTTCAAGG - Intergenic
1128617319 15:69120414-69120436 TGGGGCCCATAGGACTTTCAGGG + Intergenic
1131836071 15:96392427-96392449 TGGGGTCACTTGCACTTTCATGG - Intergenic
1134237287 16:12477044-12477066 TGCAGGCCTTAGCACCTTCCAGG - Intronic
1137351088 16:47714441-47714463 TGCAGGCCCTGGCATTTCCAGGG + Intergenic
1137491799 16:48939075-48939097 TGTGGGCCCTGGTTCTTTCAAGG - Intergenic
1143041819 17:4043748-4043770 TGCAGATCCTAGCACATTCAAGG + Intronic
1148238887 17:45986874-45986896 TGCGAGGCCTAGCAGATTCAAGG + Intronic
1151786278 17:76276597-76276619 TGTGGGGCCTGGCACTTTTATGG - Intronic
1157913655 18:51643005-51643027 TGCAGGGCCAAGCACTTACAAGG + Intergenic
1160201595 18:76801007-76801029 TGTGTGCCCTAGCAGTTTCTGGG - Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1167049013 19:47067519-47067541 TGTGGGCCCCAGCAGTTCCAAGG - Exonic
928830559 2:35477934-35477956 TCCTGGCCTTAGCATTTTCAGGG - Intergenic
930658446 2:54030157-54030179 TGGGGGCCCCAGGACCTTCAAGG + Intronic
938107808 2:128545212-128545234 TCCGGGTCCACGCACTTTCATGG - Intergenic
941462768 2:165791373-165791395 TGAGGGCTCCAGCACTTTCGTGG + Intronic
942045746 2:172098395-172098417 TGCGGGCCCTAGCACTTTCAGGG + Intergenic
942045751 2:172098417-172098439 GAAAGGCCCTAGCACTTTCAGGG + Intergenic
1169414293 20:5402817-5402839 TGCTGGGCCTTGAACTTTCATGG - Intergenic
1178981321 21:37267502-37267524 TGCGGGCCGAAGCGCTGTCACGG + Exonic
1183655049 22:39179754-39179776 TTTGGGCCCTAGCACTTGGAAGG + Intergenic
1183801400 22:40167950-40167972 TGCAGGCCCCCTCACTTTCATGG - Intronic
954036298 3:47852893-47852915 TGCGGGCCCTGGCATTTGCCCGG + Exonic
955080476 3:55653870-55653892 TGCTGGCCCCAGCTCTTTCTTGG + Intronic
956395141 3:68817880-68817902 TGAGGGCCCTAGGATTTTCAGGG + Intronic
962084364 3:132174474-132174496 TGCGGGCACCAGCCCTGTCAAGG - Intronic
969888701 4:10239892-10239914 TGAGGGCCCCAGTACCTTCAAGG + Intergenic
981645141 4:146990876-146990898 TGCTGGCCACAGCACTTTGATGG + Intergenic
988693638 5:33597268-33597290 TGTGAGCACTAGCCCTTTCAAGG - Intronic
998904974 5:146894950-146894972 TGCCGGCCCTAGAACTGGCATGG + Intronic
1002569211 5:180130441-180130463 TGTGGGCCCTGGCCCTTCCACGG + Intronic
1006178734 6:32140485-32140507 TGAGGGCCCCAGTACCTTCAAGG + Intergenic
1007252599 6:40506032-40506054 TGAGGGGCCTAGATCTTTCAAGG + Intronic
1017782543 6:157727431-157727453 TGAGGGCCCCAGTACCTTCAAGG + Intronic
1024007661 7:45239166-45239188 TGAGGGCCCTAGTACCTTCAAGG - Intergenic
1028353364 7:89877298-89877320 TGCTGGCCAAAGCACTTTGATGG + Intergenic
1032989038 7:137370623-137370645 AGCGGTCTCTAACACTTTCATGG - Intergenic
1062331011 9:136044951-136044973 TGCGGGCCCCACCCTTTTCAGGG - Intronic
1201482509 Y:14455247-14455269 TGCGGGCCCAAGCCTATTCAAGG - Intergenic