ID: 942045839

View in Genome Browser
Species Human (GRCh38)
Location 2:172099073-172099095
Sequence GCCGCGGGGGACCTCCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045839_942045850 9 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045850 2:172099105-172099127 GCCGAGCCTGGCCATCTAGGCGG No data
942045839_942045856 17 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045856 2:172099113-172099135 TGGCCATCTAGGCGGGCGCGGGG No data
942045839_942045854 15 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
942045839_942045848 -3 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045848 2:172099093-172099115 GGCGGCTGGGGTGCCGAGCCTGG No data
942045839_942045857 18 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045857 2:172099114-172099136 GGCCATCTAGGCGGGCGCGGGGG No data
942045839_942045861 30 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG No data
942045839_942045849 6 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045849 2:172099102-172099124 GGTGCCGAGCCTGGCCATCTAGG No data
942045839_942045859 21 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045859 2:172099117-172099139 CATCTAGGCGGGCGCGGGGGCGG No data
942045839_942045860 24 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045860 2:172099120-172099142 CTAGGCGGGCGCGGGGGCGGTGG No data
942045839_942045855 16 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045855 2:172099112-172099134 CTGGCCATCTAGGCGGGCGCGGG No data
942045839_942045852 10 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045852 2:172099106-172099128 CCGAGCCTGGCCATCTAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045839 Original CRISPR GCCGCGGGGGACCTCCTGTC AGG (reversed) Intergenic