ID: 942045845

View in Genome Browser
Species Human (GRCh38)
Location 2:172099087-172099109
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045845_942045859 7 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045859 2:172099117-172099139 CATCTAGGCGGGCGCGGGGGCGG No data
942045845_942045850 -5 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045850 2:172099105-172099127 GCCGAGCCTGGCCATCTAGGCGG No data
942045845_942045852 -4 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045852 2:172099106-172099128 CCGAGCCTGGCCATCTAGGCGGG No data
942045845_942045856 3 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045856 2:172099113-172099135 TGGCCATCTAGGCGGGCGCGGGG No data
942045845_942045865 27 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045865 2:172099137-172099159 CGGTGGCGCCGGCGCCGGAGGGG No data
942045845_942045862 22 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045862 2:172099132-172099154 GGGGGCGGTGGCGCCGGCGCCGG No data
942045845_942045863 25 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045863 2:172099135-172099157 GGCGGTGGCGCCGGCGCCGGAGG No data
942045845_942045855 2 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045855 2:172099112-172099134 CTGGCCATCTAGGCGGGCGCGGG No data
942045845_942045861 16 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG No data
942045845_942045864 26 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045845_942045857 4 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045857 2:172099114-172099136 GGCCATCTAGGCGGGCGCGGGGG No data
942045845_942045860 10 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045860 2:172099120-172099142 CTAGGCGGGCGCGGGGGCGGTGG No data
942045845_942045849 -8 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045849 2:172099102-172099124 GGTGCCGAGCCTGGCCATCTAGG No data
942045845_942045854 1 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045845 Original CRISPR TCGGCACCCCAGCCGCCGCG GGG (reversed) Intergenic