ID: 942045847

View in Genome Browser
Species Human (GRCh38)
Location 2:172099089-172099111
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045847_942045855 0 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045855 2:172099112-172099134 CTGGCCATCTAGGCGGGCGCGGG No data
942045847_942045857 2 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045857 2:172099114-172099136 GGCCATCTAGGCGGGCGCGGGGG No data
942045847_942045850 -7 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045850 2:172099105-172099127 GCCGAGCCTGGCCATCTAGGCGG No data
942045847_942045852 -6 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045852 2:172099106-172099128 CCGAGCCTGGCCATCTAGGCGGG No data
942045847_942045849 -10 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045849 2:172099102-172099124 GGTGCCGAGCCTGGCCATCTAGG No data
942045847_942045860 8 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045860 2:172099120-172099142 CTAGGCGGGCGCGGGGGCGGTGG No data
942045847_942045856 1 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045856 2:172099113-172099135 TGGCCATCTAGGCGGGCGCGGGG No data
942045847_942045861 14 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG No data
942045847_942045863 23 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045863 2:172099135-172099157 GGCGGTGGCGCCGGCGCCGGAGG No data
942045847_942045864 24 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045847_942045866 29 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045866 2:172099141-172099163 GGCGCCGGCGCCGGAGGGGCAGG No data
942045847_942045854 -1 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
942045847_942045859 5 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045859 2:172099117-172099139 CATCTAGGCGGGCGCGGGGGCGG No data
942045847_942045867 30 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045867 2:172099142-172099164 GCGCCGGCGCCGGAGGGGCAGGG No data
942045847_942045862 20 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045862 2:172099132-172099154 GGGGGCGGTGGCGCCGGCGCCGG No data
942045847_942045865 25 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045865 2:172099137-172099159 CGGTGGCGCCGGCGCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045847 Original CRISPR GCTCGGCACCCCAGCCGCCG CGG (reversed) Intergenic