ID: 942045848

View in Genome Browser
Species Human (GRCh38)
Location 2:172099093-172099115
Sequence GGCGGCTGGGGTGCCGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045837_942045848 -2 Left 942045837 2:172099072-172099094 CCCTGACAGGAGGTCCCCCGCGG No data
Right 942045848 2:172099093-172099115 GGCGGCTGGGGTGCCGAGCCTGG No data
942045831_942045848 28 Left 942045831 2:172099042-172099064 CCGACCCTCAGGCTGCTGCAGAG No data
Right 942045848 2:172099093-172099115 GGCGGCTGGGGTGCCGAGCCTGG No data
942045833_942045848 23 Left 942045833 2:172099047-172099069 CCTCAGGCTGCTGCAGAGCTCAG No data
Right 942045848 2:172099093-172099115 GGCGGCTGGGGTGCCGAGCCTGG No data
942045839_942045848 -3 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045848 2:172099093-172099115 GGCGGCTGGGGTGCCGAGCCTGG No data
942045832_942045848 24 Left 942045832 2:172099046-172099068 CCCTCAGGCTGCTGCAGAGCTCA No data
Right 942045848 2:172099093-172099115 GGCGGCTGGGGTGCCGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045848 Original CRISPR GGCGGCTGGGGTGCCGAGCC TGG Intergenic