ID: 942045853

View in Genome Browser
Species Human (GRCh38)
Location 2:172099111-172099133
Sequence CCGCGCCCGCCTAGATGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045853_942045867 8 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045867 2:172099142-172099164 GCGCCGGCGCCGGAGGGGCAGGG No data
942045853_942045864 2 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045853_942045865 3 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045865 2:172099137-172099159 CGGTGGCGCCGGCGCCGGAGGGG No data
942045853_942045866 7 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045866 2:172099141-172099163 GGCGCCGGCGCCGGAGGGGCAGG No data
942045853_942045873 22 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045873 2:172099156-172099178 GGGGCAGGGCAGGCGGAGGCTGG No data
942045853_942045862 -2 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045862 2:172099132-172099154 GGGGGCGGTGGCGCCGGCGCCGG No data
942045853_942045872 18 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045872 2:172099152-172099174 CGGAGGGGCAGGGCAGGCGGAGG No data
942045853_942045870 15 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045870 2:172099149-172099171 CGCCGGAGGGGCAGGGCAGGCGG No data
942045853_942045869 12 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045869 2:172099146-172099168 CGGCGCCGGAGGGGCAGGGCAGG No data
942045853_942045863 1 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045863 2:172099135-172099157 GGCGGTGGCGCCGGCGCCGGAGG No data
942045853_942045861 -8 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045853 Original CRISPR CCGCGCCCGCCTAGATGGCC AGG (reversed) Intergenic