ID: 942045854

View in Genome Browser
Species Human (GRCh38)
Location 2:172099111-172099133
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045845_942045854 1 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
942045847_942045854 -1 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
942045846_942045854 0 Left 942045846 2:172099088-172099110 CCCGCGGCGGCTGGGGTGCCGAG No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
942045844_942045854 2 Left 942045844 2:172099086-172099108 CCCCCGCGGCGGCTGGGGTGCCG No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
942045837_942045854 16 Left 942045837 2:172099072-172099094 CCCTGACAGGAGGTCCCCCGCGG No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
942045839_942045854 15 Left 942045839 2:172099073-172099095 CCTGACAGGAGGTCCCCCGCGGC No data
Right 942045854 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type