ID: 942045864

View in Genome Browser
Species Human (GRCh38)
Location 2:172099136-172099158
Sequence GCGGTGGCGCCGGCGCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045851_942045864 7 Left 942045851 2:172099106-172099128 CCGAGCCTGGCCATCTAGGCGGG No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045846_942045864 25 Left 942045846 2:172099088-172099110 CCCGCGGCGGCTGGGGTGCCGAG No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045847_942045864 24 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045853_942045864 2 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045844_942045864 27 Left 942045844 2:172099086-172099108 CCCCCGCGGCGGCTGGGGTGCCG No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045858_942045864 -3 Left 942045858 2:172099116-172099138 CCATCTAGGCGGGCGCGGGGGCG No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data
942045845_942045864 26 Left 942045845 2:172099087-172099109 CCCCGCGGCGGCTGGGGTGCCGA No data
Right 942045864 2:172099136-172099158 GCGGTGGCGCCGGCGCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045864 Original CRISPR GCGGTGGCGCCGGCGCCGGA GGG Intergenic