ID: 942045866

View in Genome Browser
Species Human (GRCh38)
Location 2:172099141-172099163
Sequence GGCGCCGGCGCCGGAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045847_942045866 29 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045866 2:172099141-172099163 GGCGCCGGCGCCGGAGGGGCAGG No data
942045851_942045866 12 Left 942045851 2:172099106-172099128 CCGAGCCTGGCCATCTAGGCGGG No data
Right 942045866 2:172099141-172099163 GGCGCCGGCGCCGGAGGGGCAGG No data
942045853_942045866 7 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045866 2:172099141-172099163 GGCGCCGGCGCCGGAGGGGCAGG No data
942045846_942045866 30 Left 942045846 2:172099088-172099110 CCCGCGGCGGCTGGGGTGCCGAG No data
Right 942045866 2:172099141-172099163 GGCGCCGGCGCCGGAGGGGCAGG No data
942045858_942045866 2 Left 942045858 2:172099116-172099138 CCATCTAGGCGGGCGCGGGGGCG No data
Right 942045866 2:172099141-172099163 GGCGCCGGCGCCGGAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045866 Original CRISPR GGCGCCGGCGCCGGAGGGGC AGG Intergenic