ID: 942045867

View in Genome Browser
Species Human (GRCh38)
Location 2:172099142-172099164
Sequence GCGCCGGCGCCGGAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045858_942045867 3 Left 942045858 2:172099116-172099138 CCATCTAGGCGGGCGCGGGGGCG No data
Right 942045867 2:172099142-172099164 GCGCCGGCGCCGGAGGGGCAGGG No data
942045853_942045867 8 Left 942045853 2:172099111-172099133 CCTGGCCATCTAGGCGGGCGCGG No data
Right 942045867 2:172099142-172099164 GCGCCGGCGCCGGAGGGGCAGGG No data
942045847_942045867 30 Left 942045847 2:172099089-172099111 CCGCGGCGGCTGGGGTGCCGAGC No data
Right 942045867 2:172099142-172099164 GCGCCGGCGCCGGAGGGGCAGGG No data
942045851_942045867 13 Left 942045851 2:172099106-172099128 CCGAGCCTGGCCATCTAGGCGGG No data
Right 942045867 2:172099142-172099164 GCGCCGGCGCCGGAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045867 Original CRISPR GCGCCGGCGCCGGAGGGGCA GGG Intergenic