ID: 942045878

View in Genome Browser
Species Human (GRCh38)
Location 2:172099203-172099225
Sequence GGATTCTCCGGCCGGCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942045878_942045889 -4 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045889 2:172099222-172099244 ATCCCTCGCGGGGACTCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 52
942045878_942045896 3 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045896 2:172099229-172099251 GCGGGGACTCGGGAGGGGGCGGG 0: 1
1: 0
2: 16
3: 106
4: 990
942045878_942045890 -3 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045890 2:172099223-172099245 TCCCTCGCGGGGACTCGGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 93
942045878_942045895 2 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045895 2:172099228-172099250 CGCGGGGACTCGGGAGGGGGCGG 0: 1
1: 0
2: 3
3: 99
4: 2179
942045878_942045888 -7 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045888 2:172099219-172099241 AGAATCCCTCGCGGGGACTCGGG 0: 1
1: 0
2: 1
3: 5
4: 90
942045878_942045894 -1 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045894 2:172099225-172099247 CCTCGCGGGGACTCGGGAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 227
942045878_942045892 -2 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045892 2:172099224-172099246 CCCTCGCGGGGACTCGGGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 111
942045878_942045897 4 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045897 2:172099230-172099252 CGGGGACTCGGGAGGGGGCGGGG 0: 1
1: 3
2: 14
3: 102
4: 779
942045878_942045899 23 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045899 2:172099249-172099271 GGGGCGTGAAACCCCCGGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 36
942045878_942045898 18 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045898 2:172099244-172099266 GGGGCGGGGCGTGAAACCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 156
942045878_942045887 -8 Left 942045878 2:172099203-172099225 CCCCGCCGCCGGCCGGAGAATCC No data
Right 942045887 2:172099218-172099240 GAGAATCCCTCGCGGGGACTCGG 0: 1
1: 0
2: 0
3: 2
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942045878 Original CRISPR GGATTCTCCGGCCGGCGGCG GGG (reversed) Intergenic