ID: 942046578

View in Genome Browser
Species Human (GRCh38)
Location 2:172102551-172102573
Sequence CGGGAAAGAGCAGAGGTGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942046567_942046578 17 Left 942046567 2:172102511-172102533 CCACTAGACTGTCAAAGACTCCA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 942046578 2:172102551-172102573 CGGGAAAGAGCAGAGGTGGCGGG 0: 1
1: 0
2: 3
3: 34
4: 500
942046569_942046578 -3 Left 942046569 2:172102531-172102553 CCAGTCATCCTGGCCCGAGACGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 942046578 2:172102551-172102573 CGGGAAAGAGCAGAGGTGGCGGG 0: 1
1: 0
2: 3
3: 34
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942046578 Original CRISPR CGGGAAAGAGCAGAGGTGGC GGG Exonic
900122755 1:1055891-1055913 GGGGCAGGTGCAGAGGTGGCAGG + Exonic
901556181 1:10033013-10033035 GGGGAAAGAGTAGGGGTGGAGGG + Intronic
901846438 1:11985811-11985833 CGAGAAAGAGGGGATGTGGCAGG - Intronic
902176612 1:14655271-14655293 CCAGAAAGAGCAGAGGAGGTGGG - Intronic
903004774 1:20291425-20291447 CGAGAAAGAGAAGAGGGAGCAGG - Intronic
903018897 1:20379887-20379909 GGGGAAAGAGGGCAGGTGGCAGG - Intergenic
903742512 1:25566559-25566581 CAGGAAAGAGGAGAAGGGGCTGG - Intronic
906479611 1:46191434-46191456 CAGGAAAGGGCAGAGATTGCAGG + Intronic
907303590 1:53502375-53502397 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907303618 1:53502455-53502477 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907303652 1:53502554-53502576 AGGGAAAGAGGAGAGGGGGGAGG + Intergenic
907487531 1:54787952-54787974 AGGGTAAGGGCAGAGGTGGCTGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907589183 1:55649807-55649829 AGGGAAAGAGGAAAGATGGCAGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908473847 1:64470276-64470298 CGGGGAAGAGGAGCGGCGGCCGG - Intergenic
912637829 1:111315043-111315065 GGAGAAAGAGCAGAGTTGGGGGG + Intronic
912838916 1:113021589-113021611 AGAGAAAAAGCTGAGGTGGCTGG - Intergenic
912978889 1:114352986-114353008 TGGGGAAGAGCAGATGGGGCTGG + Intergenic
912982143 1:114384749-114384771 CAGGAAAGAGCAAAGGTGTACGG - Intergenic
913218604 1:116641662-116641684 AGGCAGAGAGCAGAGCTGGCAGG + Intronic
913452438 1:119001296-119001318 CGGGCAGGTGCAGAGGTGACAGG + Intergenic
913939432 1:125087399-125087421 CGGGAAAAAGCTGCGGCGGCGGG + Intergenic
914044041 1:144076996-144077018 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
914044382 1:144078232-144078254 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
914133728 1:144882455-144882477 GGGGAAAAAGCCGTGGTGGCAGG + Intergenic
914134016 1:144883472-144883494 CGGCAAAAAGCCGTGGTGGCGGG + Intergenic
914694693 1:150066950-150066972 CAGGCAAGAGCCGAGGTGACTGG - Intergenic
915931449 1:160062958-160062980 CCTGGAAGAGCACAGGTGGCAGG - Intronic
917735976 1:177920882-177920904 CTGGAAAGGGGAGAGGTGGTGGG - Intergenic
918065040 1:181094897-181094919 CGGGAGGGAGCAGTGGTAGCAGG - Intergenic
918208263 1:182328639-182328661 CGGTCAGGATCAGAGGTGGCTGG - Intergenic
919648659 1:200123421-200123443 AGGGAAGCAGCAGATGTGGCTGG + Intronic
919806036 1:201381563-201381585 CAGGAAGGAGCAGAGGTCTCTGG + Exonic
919894226 1:201998772-201998794 TAGGAAAGGGCAGAGCTGGCTGG + Intronic
919935670 1:202248948-202248970 TGGGAAAGAGGAGAGAAGGCAGG + Intronic
920387806 1:205580636-205580658 GGGGACAGAGGAGAGGTGGCGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922673849 1:227538240-227538262 AGTGAAGAAGCAGAGGTGGCAGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923524825 1:234764429-234764451 AGGGAGAGAGCATAGGTGGTGGG - Intergenic
1065019632 10:21494058-21494080 GGGGAAAAAGCAGAAGTTGCTGG - Exonic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066443846 10:35464044-35464066 TGGGAAAGAGGAGCGGTGTCAGG + Intronic
1066950314 10:42111218-42111240 GGGGAAAAAGCCGTGGTGGCAGG + Intergenic
1066963854 10:42243272-42243294 CGGCAAAAAGCCGCGGTGGCAGG - Intergenic
1067272525 10:44804603-44804625 GGGGAAAGTGCAGAGGAGGTGGG - Intergenic
1067828584 10:49597089-49597111 CAGGAAAGCACAGAGGTGGAGGG - Intergenic
1068787224 10:60989778-60989800 GGGGAGAGAGCAGGGGTGGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069819148 10:71216984-71217006 CAGGAAAGGGCAGAGGGGGCTGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071942678 10:90606955-90606977 TGGGCAACAACAGAGGTGGCTGG + Intergenic
1072614095 10:97038078-97038100 CAGGAAAGAGCAGAGCAGGGAGG - Intronic
1073110796 10:101061998-101062020 CAGGACGGAGCAGAGGTGGCCGG + Exonic
1073147717 10:101291682-101291704 CGGGAGAGGGCAGAGGGCGCCGG + Intergenic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1074187923 10:111113210-111113232 CTGGAAAGTCCAGAGGTGGGTGG + Intergenic
1074756768 10:116629546-116629568 TGGGAAAGAGCACAGCAGGCTGG + Intronic
1074850248 10:117433673-117433695 CAGGAAAGAGCAAAGGTGGCTGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077079625 11:719436-719458 CTGGAAAGAGGAGAGGTGAAGGG + Intronic
1077317961 11:1927661-1927683 GGGGCAGGAGCAGAGGAGGCAGG + Intronic
1078307859 11:10208567-10208589 CAGGAAAGAACACAGGTGGAGGG + Intronic
1078926840 11:15882873-15882895 AGGAAAAGAGCAGAGGTTCCAGG - Intergenic
1078933957 11:15936134-15936156 AGGGAAAGAGCAGAGGACTCAGG - Intergenic
1079119948 11:17674879-17674901 CAGGAAGGAGCAGAGGTTGTGGG + Intergenic
1080576482 11:33604062-33604084 AGGGAAAGCTCAGAGGTGGAAGG + Intronic
1082208508 11:49468446-49468468 GGGGAAAGAGGAGAGGGGGATGG + Intergenic
1083792383 11:64994375-64994397 TGGGATGGAGAAGAGGTGGCTGG + Intronic
1083882454 11:65555291-65555313 AGGGAAGGAGCAGAGGGGGATGG - Intronic
1084180879 11:67445231-67445253 GGGGGAAGAGCAGAGGTCACAGG + Intergenic
1084359579 11:68660816-68660838 AGAGAAAGTGCAGAGGTGGACGG + Intergenic
1084653200 11:70500913-70500935 CAGACATGAGCAGAGGTGGCGGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084971759 11:72775965-72775987 AGGGAAAGATCAGAGGTGGCTGG - Intronic
1085534405 11:77209416-77209438 CTGGGAAGGGCAGAGGAGGCAGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1086218018 11:84406876-84406898 AGAGAAAGAGAAGAGGTGGAAGG + Intronic
1086641108 11:89156675-89156697 GGGGAAAGAGGAGAGGGGGATGG - Intergenic
1088590206 11:111396345-111396367 CTGGAAAGGGCAGAGGGGACAGG - Intronic
1088878366 11:113954436-113954458 CGGGAAAGAGCAGGTAAGGCAGG + Intergenic
1089446306 11:118555356-118555378 CAGAGAAGAGCAGAGGTGGCAGG + Intronic
1089497350 11:118914393-118914415 GGGGAGAGAGCAGAGCAGGCAGG - Intronic
1091273482 11:134333655-134333677 TGGGACAGAGGTGAGGTGGCAGG + Intronic
1091442464 12:522022-522044 GTGGAAAGAGGAGGGGTGGCAGG - Intronic
1091828680 12:3534105-3534127 GGGGACAGAGTAGGGGTGGCAGG - Intronic
1092030357 12:5278602-5278624 CGGGAGGAAGCGGAGGTGGCAGG - Intergenic
1093817115 12:23562275-23562297 AGGGAAAGAGCAGTTGTGGCAGG + Intronic
1094468468 12:30779749-30779771 CGGGAATGTGCAGAGGTGTGGGG - Intergenic
1096106409 12:48998949-48998971 CGGGAGCGGGCAGAGGTGGAAGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096609699 12:52792871-52792893 CAAGAAAGAGCAGAGGGGACTGG + Intronic
1096650486 12:53059840-53059862 CAGGCAAGAGCAGAGGCAGCGGG - Exonic
1097184401 12:57188903-57188925 GGAGAAAGAGCTGAGCTGGCAGG + Intronic
1098567684 12:71954157-71954179 CCCGAAAGAGGAGAGGGGGCGGG + Intronic
1101225711 12:102686319-102686341 GGGGAAAGGGCAGTGGTGGTAGG - Intergenic
1101854057 12:108427531-108427553 AGGGAAAGGGGAGAGGAGGCAGG + Intergenic
1103000497 12:117382090-117382112 AGGTAAAGAGCAGGGGTGGTGGG - Intronic
1103013114 12:117473110-117473132 TGGGAAGGAGCAGGGGAGGCAGG - Intronic
1103400915 12:120641867-120641889 GAGGAAAGAGAAGAGGTGTCTGG + Intronic
1103616058 12:122153174-122153196 TGGGAATGGGGAGAGGTGGCTGG - Intergenic
1103735176 12:123056599-123056621 AGGGAAAGAGCTGAGCTGCCCGG + Intronic
1103900473 12:124301212-124301234 CGGGATCGAGCAGACGCGGCTGG - Intronic
1104787718 12:131460307-131460329 CGGGGAGGAGCAGGGGTGGGTGG - Intergenic
1104963512 12:132499029-132499051 CAGGGGACAGCAGAGGTGGCAGG - Intronic
1105214059 13:18274130-18274152 AGGGAAAGAGCAGGAGCGGCCGG + Intergenic
1105495247 13:20924986-20925008 CAGGAAACAGCAGAGGGCGCTGG - Intergenic
1105811812 13:24002000-24002022 CGGGTGGGAGCAGAGGTGGATGG + Intronic
1105941150 13:25149193-25149215 GGGGCAGGAGCAGAGGTGGCAGG - Intergenic
1105982712 13:25535191-25535213 CAGGAGAGGGCAGAGGTGTCAGG + Intronic
1106916267 13:34518550-34518572 TGGGAAATAGCAAAGGTGACAGG - Intergenic
1107025405 13:35796484-35796506 AGGGAACGAGCAGAGGTGCGGGG + Intronic
1107543105 13:41411674-41411696 CTGGACAGAGCAGAGAGGGCAGG + Intergenic
1108086444 13:46797907-46797929 CGGGTAATAGCACAGGTTGCAGG - Intergenic
1108249542 13:48550996-48551018 CTGGAGGGAGCTGAGGTGGCAGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110052760 13:70924338-70924360 CGTGAAGGAGGAGAGGAGGCAGG + Intergenic
1110553199 13:76829833-76829855 AGGGAATGAACGGAGGTGGCCGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111917978 13:94381657-94381679 TGGGAAAGTCCAGAGATGGCTGG - Intronic
1111921374 13:94414991-94415013 CGGGAAGGAGCAGAGGGGAGTGG + Intergenic
1112814065 13:103251672-103251694 AGGAAAAGGGGAGAGGTGGCAGG + Intergenic
1113040510 13:106099927-106099949 CTGCAAAGAGGAGAGGAGGCTGG + Intergenic
1113807554 13:113118438-113118460 CGGGGATGAGCAGAGCCGGCGGG + Exonic
1114873929 14:26691827-26691849 GGGGAAAGAGCAGTCATGGCTGG + Intergenic
1114896256 14:26994545-26994567 CAGAAAACAACAGAGGTGGCTGG + Intergenic
1118843016 14:69526881-69526903 CGGTAAAGTGCAGGGGTGGAAGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1122299363 14:100723250-100723272 AGGGCAAGAGCAGGGGTGGCCGG - Intergenic
1122997191 14:105271648-105271670 CAGCACAGAGCAGAGGAGGCTGG + Intronic
1123123558 14:105929180-105929202 CGGGAAAGGGCAGAGGTCACTGG + Intronic
1202883702 14_KI270722v1_random:84718-84740 CTGGAAGGGGCTGAGGTGGCAGG + Intergenic
1123406202 15:20020682-20020704 CGGGAAAGGTCAGAGGTCACTGG + Intergenic
1123515532 15:21027330-21027352 CGGGAAAGGTCAGAGGTCACTGG + Intergenic
1124995110 15:34716267-34716289 CTGGACAGGGCAGAGATGGCTGG - Intergenic
1125536689 15:40444776-40444798 CGGGAAAGAGGACTGGTGACTGG + Intronic
1125929979 15:43593634-43593656 CGGGAGACCGAAGAGGTGGCTGG + Intronic
1125943147 15:43693466-43693488 CGGGAGACCGAAGAGGTGGCTGG + Intronic
1126350254 15:47738643-47738665 CAGGAAAGAGCAGAGGAAGCAGG + Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1126967178 15:54067754-54067776 CAGGAAAAAGTAGAGGTGTCAGG - Intronic
1127354119 15:58181824-58181846 TAGGAAAGAGCAGGGTTGGCTGG + Intronic
1127844952 15:62861792-62861814 CAGGAAAGAGCGGAGGAGTCAGG - Intergenic
1127930970 15:63597339-63597361 CGGGGAGGAGGAGAGGAGGCAGG + Exonic
1128742558 15:70094215-70094237 CCTGAAAGCCCAGAGGTGGCTGG - Intronic
1129291120 15:74568599-74568621 GGGGAAAGAGAAAAGGTAGCAGG - Intronic
1129360521 15:75021217-75021239 CGGGAAAGTGCATAGTTGCCTGG - Exonic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130255672 15:82325029-82325051 CAGGAAGGAGCAGAGGGAGCTGG + Intergenic
1130599291 15:85264957-85264979 CAGGAAGGAGCAGAGGGAGCTGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132296082 15:100735460-100735482 CTGAAAAGAAGAGAGGTGGCAGG - Intergenic
1132316377 15:100893354-100893376 GGCAAAAGTGCAGAGGTGGCTGG + Intronic
1132500552 16:282924-282946 CGGGACAGAGCAGGGGCAGCAGG - Exonic
1132573011 16:652161-652183 TGGCAAGGAGCAGAGCTGGCGGG + Intronic
1132591573 16:728467-728489 CGGGTCAGAGCAGATGGGGCGGG - Intronic
1132658592 16:1051694-1051716 CAGGAAAGCGCAGAGGGGGTCGG - Intergenic
1132756288 16:1487087-1487109 AGGGCAGAAGCAGAGGTGGCGGG - Intronic
1132942664 16:2515651-2515673 GGGCAAAGAACAGAGGAGGCTGG - Intronic
1133172757 16:3992106-3992128 TGGGAAAAAGCAAAGGTTGCAGG - Intronic
1134662271 16:15993040-15993062 AAGGAAAGAGCAGGGGTGTCAGG - Intronic
1135414530 16:22258568-22258590 GGGGACGGAGCAGGGGTGGCCGG - Exonic
1135617242 16:23921963-23921985 AGGGAAAGGGCAGAGCAGGCAGG + Intronic
1135858415 16:26033080-26033102 GTGGAAAGAACACAGGTGGCCGG + Intronic
1136378808 16:29881341-29881363 CTGGAAACAGCAGAGATAGCGGG + Intronic
1136698976 16:32115641-32115663 CGGGAAAAAGCCGCGGCGGCAGG - Intergenic
1136777729 16:32880656-32880678 CGGGACAGGGCACGGGTGGCAGG + Intergenic
1136892894 16:33980858-33980880 CGGGACAGGGCACGGGTGGCAGG - Intergenic
1137056479 16:35748738-35748760 CTGGAAAGGGCAAAGGTGGGCGG - Intergenic
1137084296 16:36101635-36101657 CGGCAAAAAGCCGCGGTGGCGGG + Intergenic
1137859627 16:51833301-51833323 AGGGTTGGAGCAGAGGTGGCAGG + Intergenic
1139073947 16:63419920-63419942 AGGGAAAGAGAGGAGGTGACTGG - Intergenic
1139264126 16:65623390-65623412 AAGGAAAGAGCTGAGGAGGCAGG + Intergenic
1141532176 16:84654075-84654097 AGGGAAAGAGCCCAGGGGGCAGG - Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1141780538 16:86157512-86157534 GGGGAAAGAGAGGAAGTGGCAGG - Intergenic
1141834803 16:86531713-86531735 AGGGACAGAGCAGAGGGGCCAGG - Exonic
1142135495 16:88450145-88450167 CCGGAAAGGGGAGAGGAGGCTGG + Intergenic
1142228696 16:88889381-88889403 CAGGAAAAAGCAGAGGAGGCAGG + Intronic
1203080145 16_KI270728v1_random:1142765-1142787 CGGGACAGGGCACGGGTGGCAGG + Intergenic
1142749393 17:1978190-1978212 CTGGAGACAGCAGAGGCGGCAGG - Intronic
1143120351 17:4602807-4602829 GGGTGAAGAGCAAAGGTGGCAGG + Intronic
1143447945 17:7019837-7019859 CGGGACAGAGCAGGGCTGGCGGG - Intergenic
1143782992 17:9239276-9239298 CGGGTGAGAGCAGTGCTGGCGGG - Intronic
1144643699 17:16954096-16954118 GAGGGAAGACCAGAGGTGGCTGG + Intronic
1144686362 17:17228681-17228703 AGGGAATGACCAGAGGAGGCAGG + Intronic
1145205091 17:20980287-20980309 GAGGGAAGACCAGAGGTGGCTGG - Intergenic
1146883082 17:36454161-36454183 TTGGAGAGAGCAGAGGTGACTGG + Intergenic
1147019754 17:37521777-37521799 CGTGAAAGAGCTGACGAGGCAGG + Intronic
1147217537 17:38909309-38909331 CTGGAAAGTGAAGAGGAGGCTGG + Intronic
1147840592 17:43368931-43368953 CGGGAAGGAGGAGAGGGGCCTGG + Intergenic
1147978605 17:44261543-44261565 TGGGAAAGAACGGAGGAGGCTGG + Intronic
1147990888 17:44332652-44332674 GGGGAGAGAGCTGAGGTGGGAGG - Intergenic
1148105523 17:45116695-45116717 CAGGATGGTGCAGAGGTGGCGGG + Exonic
1148326191 17:46784743-46784765 GGGGAAAGCGCAGAGGAGGTAGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149637297 17:58181102-58181124 AGAGAAAGAGCAGAGAGGGCAGG - Intergenic
1149792571 17:59492200-59492222 TGGGGAAGAGCAGGGCTGGCAGG + Intergenic
1150300227 17:64041608-64041630 GAGGAAAGACCAGAGGTGACCGG + Exonic
1150998249 17:70343826-70343848 CTGGAAAGGGGAGAGTTGGCTGG + Intergenic
1151615333 17:75206441-75206463 CGGGAAAAAGCACAGGTCACAGG + Intronic
1151993199 17:77591765-77591787 CTGGAAAGGGCAGAGGGGGGAGG + Intergenic
1152083085 17:78200608-78200630 CGGGAAGAGGCAGAGGTGACTGG + Intronic
1152581879 17:81169092-81169114 CGGGACAGAGCACAGGTGGAGGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155166530 18:23236661-23236683 TGCGAACGATCAGAGGTGGCCGG - Intronic
1155461792 18:26091195-26091217 CGAGATAGGGCAGAGGTGGAAGG + Intronic
1156047721 18:32896414-32896436 CGAGAAAGAGGGGAGGTGCCAGG - Intergenic
1156194868 18:34762989-34763011 GAGGAAAGTGCAGAGGTGCCAGG + Intronic
1156458848 18:37310048-37310070 GGGAAAAGAGAGGAGGTGGCAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158437040 18:57441033-57441055 CGGGAGCGGGCAGAGGAGGCGGG + Intronic
1158559245 18:58499705-58499727 GGGGCAAGAGCACAGGAGGCAGG - Intronic
1159191653 18:65052900-65052922 GTGGAAAGAGCAGAGGTGAGTGG - Intergenic
1160040916 18:75344841-75344863 TGGGGAGGACCAGAGGTGGCCGG - Intergenic
1161288427 19:3480295-3480317 CGAGAAAAAGGAGAGGGGGCAGG - Intronic
1161326040 19:3664766-3664788 CGGGACAGAGCAGAGGGGAGGGG - Intronic
1161589216 19:5121236-5121258 GGGGAAAGAGCAGAGGCCGGGGG + Intronic
1161712847 19:5859541-5859563 CGGGACAGAGCAGAGGAGAGCGG + Intergenic
1162384005 19:10350429-10350451 TGAGACAGCGCAGAGGTGGCTGG - Intergenic
1162796859 19:13091640-13091662 TGGCACAGAGCAGAGGGGGCTGG - Intronic
1162950917 19:14071962-14071984 GGGGAAAGAGCAGCTGGGGCCGG - Intergenic
1163106842 19:15128328-15128350 AGGAAGAGAGCAGAGGAGGCAGG + Intergenic
1163665837 19:18603859-18603881 CGGGCCAGAGCCGAGGAGGCGGG + Intronic
1163796783 19:19342450-19342472 GAGGAAGGAGCAGGGGTGGCTGG + Intronic
1164411118 19:28006263-28006285 AGGGAGAGAGAAGAGATGGCCGG - Intergenic
1164492759 19:28729509-28729531 GAGGAAAGAGCACAGGTGGGTGG - Intergenic
1166931433 19:46303841-46303863 CGGGAAAGAGAAAAGGAGGACGG - Intronic
1167160721 19:47765759-47765781 GGGCACTGAGCAGAGGTGGCGGG + Intergenic
1167192740 19:48003017-48003039 CAAGAAACAGCAGCGGTGGCAGG + Intronic
1167565668 19:50255120-50255142 GGGGAAGGAGAGGAGGTGGCAGG - Intronic
1167621702 19:50564374-50564396 GGGGAAGGAGCAGGGGAGGCGGG + Intronic
1167708229 19:51094400-51094422 AGGGAAAAAGGAGAGGGGGCAGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1202659127 1_KI270708v1_random:51866-51888 CTGGAAGGGGCTGAGGTGGCAGG + Intergenic
1202683272 1_KI270712v1_random:29309-29331 CGGCAAAAAGCCGTGGTGGCGGG - Intergenic
1202683932 1_KI270712v1_random:31623-31645 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
925019535 2:557819-557841 CAGGAAACAGCAGAGGCGTCCGG - Intergenic
925222952 2:2157448-2157470 AGGGGAAAAGCAGAGGTGGGAGG + Intronic
925279982 2:2677122-2677144 GGAGAGAAAGCAGAGGTGGCAGG - Intergenic
925482602 2:4292821-4292843 TGTGAAAGAGCACAGGTGTCTGG - Intergenic
925871446 2:8274986-8275008 AGGGAGAGAGATGAGGTGGCCGG + Intergenic
926130171 2:10297995-10298017 GGGGAAAGAGCGGGGGTGGGGGG + Intergenic
926253304 2:11168658-11168680 CTGGACAGAGCAGAGGAGGGAGG - Intronic
926258718 2:11236350-11236372 CAGAAAAGAGCAGAGGAGGTAGG + Intronic
927180238 2:20440732-20440754 CTGAAAAGGACAGAGGTGGCAGG + Intergenic
927469501 2:23362454-23362476 GGGGAGAGAGCAGTGGTGCCAGG + Intergenic
928172754 2:29013950-29013972 CAGGAAAGGGCAGAGTTGCCAGG - Intronic
928376247 2:30777048-30777070 AGTGAAAGGGCAGAGCTGGCTGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929824043 2:45296187-45296209 AAGGAAAGGGCAGAGGTGGAAGG - Intergenic
929869577 2:45746964-45746986 TGGGACACTGCAGAGGTGGCGGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931235736 2:60411017-60411039 CGAGAAAGGGCAGGGCTGGCAGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934042524 2:88139986-88140008 CAGGAAACAGCAGAGAAGGCAGG + Intergenic
934248471 2:90325709-90325731 GGGGAAAAAGCCGCGGTGGCGGG + Intergenic
934300260 2:91772620-91772642 AGGGAAAGAGCAGGAGCGGCCGG - Intergenic
934558647 2:95300838-95300860 GGGCAGAGAGCTGAGGTGGCAGG - Intronic
935285352 2:101559695-101559717 CTGGCAGGAGTAGAGGTGGCTGG - Intergenic
935593030 2:104857859-104857881 CGGGAAGGAGCAGAGGGAGAGGG + Exonic
937295325 2:120806667-120806689 CGGGGAGGCGCAGAGATGGCTGG + Intronic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938330915 2:130447604-130447626 CGGGGAAAAGCAGAGGTGGGGGG - Intergenic
938518313 2:132038347-132038369 GGGGAAAGAGCCGCGGCGGCAGG + Intergenic
938774263 2:134527519-134527541 AGGGGAAGAGCAGCTGTGGCAGG + Intronic
939105651 2:137945485-137945507 CTGCAGTGAGCAGAGGTGGCTGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939642096 2:144652987-144653009 TGGGAGAGAGGAGAGGTGACAGG + Intergenic
939801817 2:146720481-146720503 CTGGAAGGAGCGAAGGTGGCAGG - Intergenic
940074771 2:149729130-149729152 GGGCAGAGAGGAGAGGTGGCAGG + Intergenic
940405117 2:153292558-153292580 CAGCAAAGAGCTGAGGTTGCAGG + Intergenic
942046578 2:172102551-172102573 CGGGAAAGAGCAGAGGTGGCGGG + Exonic
942726690 2:179016817-179016839 TGGTAAAGAGCAGAGTAGGCTGG + Intronic
943096762 2:183438621-183438643 AGGGACAGAGCATAGGTGGGAGG - Intergenic
943396229 2:187338682-187338704 CCAGAAGGGGCAGAGGTGGCAGG + Intergenic
946175850 2:217921565-217921587 CTGGAAGGGGCAGAGGTGGCTGG + Intronic
948342867 2:237269228-237269250 GGGAAAAGAGCAGAGGTGTGGGG - Intergenic
948492906 2:238325006-238325028 CGGGAGGGAGCAGGAGTGGCAGG - Intronic
948825048 2:240570014-240570036 TGGGAAAAAGGTGAGGTGGCAGG - Intronic
1169442082 20:5640997-5641019 CAGGAAAGAGCAGAAGGGGCCGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173444508 20:43105694-43105716 TGAGAAAGAGCAGAGAAGGCTGG - Intronic
1173907708 20:46640949-46640971 CGGGAAAGTGGAAAGTTGGCTGG + Intronic
1173958869 20:47055966-47055988 ATGGAAGGAGCAGGGGTGGCGGG - Intronic
1174653683 20:52152166-52152188 CGGGACAGAGCAAAGCTGGATGG + Exonic
1174857642 20:54061877-54061899 TGGCAAAGAACAGCGGTGGCTGG + Intronic
1174913976 20:54636037-54636059 GGTGAAAGAGCAGAGAGGGCCGG + Intronic
1175070298 20:56327517-56327539 CTGGAAGGAGGAGAGGTGCCTGG - Intergenic
1175826027 20:61936997-61937019 CAGGACTGAGCAGAGGCGGCCGG + Exonic
1176010126 20:62888980-62889002 CGATAAAGAGCAGAGGCGTCTGG - Intronic
1176182298 20:63756092-63756114 CAGGGAAGAGCAGAGGTCTCTGG + Intronic
1176586801 21:8595417-8595439 GGGGAAAAAGCCGAGGCGGCGGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179647799 21:42785826-42785848 CACGAAGGAGCAGAGGGGGCAGG + Intergenic
1180269551 22:10572094-10572116 CGGGAAAAAGCCGCGGCGGCGGG - Intergenic
1180269630 22:10572397-10572419 GGGGAAAAAGCCGAGGCGGCGGG - Intergenic
1180326586 22:11435390-11435412 CTGGAAGGGGCTGAGGTGGCAGG + Intergenic
1180534680 22:16387221-16387243 GGGCAAAAAGCGGAGGTGGCGGG - Intergenic
1180819901 22:18819715-18819737 GGGCAGAGAGCAGAGCTGGCAGG + Intergenic
1180823534 22:18847928-18847950 TGGGAATGGGAAGAGGTGGCAGG - Exonic
1181189205 22:21126618-21126640 TGGGAATGGGAAGAGGTGGCAGG + Exonic
1181206122 22:21254190-21254212 GGGCAGAGAGCAGAGCTGGCAGG + Intergenic
1181209994 22:21283877-21283899 TGGGAATGGGAAGAGGTGGCAGG - Intergenic
1181399525 22:22643067-22643089 TGGGAATGGGAAGAGGTGGCAGG + Intergenic
1181440708 22:22933979-22934001 AGGGAATGAGCAGAGGATGCTGG + Intergenic
1181649895 22:24253001-24253023 TGGGAATCAGAAGAGGTGGCAGG - Intergenic
1181707483 22:24657745-24657767 TGGGAATCAGAAGAGGTGGCAGG + Intergenic
1182394398 22:30025032-30025054 GGTGAAAGAGGAGAGGTGGGAGG - Intronic
1182501617 22:30752122-30752144 CTGCAGTGAGCAGAGGTGGCTGG - Intronic
1183034456 22:35130686-35130708 TGAGGAAGAGCAGAGGAGGCAGG + Intergenic
1184300659 22:43557083-43557105 CTGGAAAGAACACAGGTGGATGG + Intronic
1184532035 22:45062217-45062239 TGGGGCAGAGCAGAGCTGGCTGG + Intergenic
1184537956 22:45100245-45100267 GATGAAGGAGCAGAGGTGGCCGG + Intergenic
1184611959 22:45609816-45609838 ATGGAAAGAGCACAGGAGGCCGG - Intergenic
1184709732 22:46242061-46242083 GGGGCAAGAGAAGAGGTGGCAGG - Exonic
1184866594 22:47205026-47205048 GGAGAGAGAGCAGAGGTGGAGGG + Intergenic
1185038820 22:48493920-48493942 AGTGAAAGAGCAGGGGTGGAAGG - Intronic
1185221916 22:49633284-49633306 TCAGAAAGAGCAGAGGAGGCAGG - Intronic
1203216953 22_KI270731v1_random:11556-11578 TGGGAATGGGAAGAGGTGGCAGG + Intergenic
1203220799 22_KI270731v1_random:41238-41260 GGGCAGAGAGCAGAGCTGGCAGG - Intergenic
1203270026 22_KI270734v1_random:45583-45605 GGGCAGAGAGCAGAGCTGGCAGG + Intergenic
1203273676 22_KI270734v1_random:73834-73856 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1203289206 22_KI270735v1_random:17613-17635 CGGGAAAAAGGCGCGGTGGCGGG + Intergenic
950756022 3:15173373-15173395 GGGGAAAGAGCAGAGAAGGTGGG - Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
953929389 3:46998435-46998457 CGGGAATGAGCAGAGGGCTCAGG - Intronic
954441471 3:50524626-50524648 GGGCAGAGAGCAGAGCTGGCAGG - Intergenic
954800703 3:53185579-53185601 GGGGAGGGAGCAGAGGTGGGGGG - Intronic
955391516 3:58525724-58525746 CAGAAGTGAGCAGAGGTGGCTGG + Intronic
955503696 3:59610053-59610075 CAGCAGAGAGCAGAGGTGTCAGG + Intergenic
956170476 3:66429813-66429835 GGGGAGAGAGAAGAGATGGCGGG + Intronic
956368242 3:68529709-68529731 AGGGAGAGAGGAGAGGTGCCAGG + Intronic
959208336 3:103342369-103342391 CTGGCAATAACAGAGGTGGCAGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960050176 3:113232101-113232123 AGGGAAGGAGCAGAGGGGGTGGG - Intronic
961394461 3:126577581-126577603 AGAGAAAGTGCAGAGCTGGCTGG + Intronic
961457530 3:127031548-127031570 CGGGAGCCAGCAGAAGTGGCAGG - Intronic
963199082 3:142568660-142568682 CTGGAAAGAGCAGGGATGCCTGG - Intronic
966128777 3:176610808-176610830 CTAGAAAGAGCAGAGGTGCAGGG + Intergenic
967422808 3:189292817-189292839 TGGCAACGAGCAGAGATGGCTGG + Intronic
968735706 4:2295631-2295653 TGGGAAGGAGCAGAGGGGACAGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969280487 4:6167340-6167362 CAGGCCAGAGCAGAGGAGGCTGG - Intronic
969297311 4:6277666-6277688 CGGGAAAGAGCAGACGGCACCGG + Exonic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973304869 4:48635093-48635115 AGGGAAGAAGCAGAGGTGGAAGG + Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978112209 4:104976901-104976923 CGGGAAACAGCAGATGATGCAGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981071453 4:140544778-140544800 CTGGAAAGAACAGAGGGAGCTGG - Intronic
982106725 4:152017758-152017780 GGGGAGACAGCAGAGGGGGCCGG + Intergenic
983301352 4:165930045-165930067 CCAGAAAGAGCAGACTTGGCTGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983780940 4:171669284-171669306 AAGGAAAGTGCAGAGGTGCCAGG + Intergenic
984093832 4:175409686-175409708 TGGGCAAGAGCAGGGTTGGCTGG - Intergenic
984358831 4:178701353-178701375 CAGGAAAGAGCTGAGCTGCCAGG - Intergenic
985075366 4:186208816-186208838 CCTGAAAGAGCAGTGGGGGCTGG - Intronic
985494045 5:194673-194695 GGGGAAAGAGCACAGGTGAGAGG - Intronic
986149187 5:5111400-5111422 CAGGACAGAGAAGAGGTGCCTGG + Intergenic
986151336 5:5133040-5133062 CGGGCCAGAGGGGAGGTGGCAGG - Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986773542 5:10994436-10994458 GGGGAAAGAGGAGCGGGGGCCGG + Intronic
987587475 5:19874875-19874897 CAGGATGGAGCAGAGGTAGCGGG + Intronic
987708331 5:21482309-21482331 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
987708507 5:21483116-21483138 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
987909087 5:24118179-24118201 GGGGAAAGAGGAAAGGTGGCTGG - Intronic
988503656 5:31803431-31803453 TGGGAAGGAACAGAGGAGGCAGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988751104 5:34191029-34191051 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
988751282 5:34191839-34191861 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988987026 5:36630388-36630410 GGGGAAAGAGAAGAGTGGGCAGG - Intronic
990245379 5:53859076-53859098 CGGGTTCGAGCAGCGGTGGCAGG - Intergenic
991736418 5:69633760-69633782 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991736593 5:69634573-69634595 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991758298 5:69899754-69899776 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
991758472 5:69900570-69900592 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
991812916 5:70489399-70489421 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991815874 5:70509876-70509898 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991816047 5:70510689-70510711 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991816222 5:70511499-70511521 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
991837701 5:70775636-70775658 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
992198422 5:74362093-74362115 CTGAAAACAGCAAAGGTGGCTGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993095519 5:83474192-83474214 CGGGAAAGTGGAGAGAAGGCGGG + Intronic
993274884 5:85844204-85844226 CGGCAGAGAGGAGAAGTGGCTGG - Intergenic
994289412 5:98010669-98010691 TGGGGAAGAGGAGAGGTGGGAGG - Intergenic
994420401 5:99523323-99523345 CGGGAGTGGGAAGAGGTGGCAGG + Intergenic
994486974 5:100392629-100392651 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
997294626 5:132761878-132761900 CGGCAAAGGGCAGATGTGCCTGG + Exonic
997903885 5:137795004-137795026 GGGGAGACAGTAGAGGTGGCAGG + Intergenic
997951133 5:138243421-138243443 AGGGAAAAAGAAGAGGTGGTGGG - Intergenic
998707947 5:144785788-144785810 GGGAAAAGAGAAGAGGTGACAGG - Intergenic
998743217 5:145228723-145228745 CGGGCCCGAGCAGCGGTGGCAGG - Intergenic
998849047 5:146337422-146337444 CGGGAACCAGCGGAGGGGGCTGG + Intronic
1001020031 5:168174912-168174934 TGGGAGAGAGCAGTGGTAGCTGG + Intronic
1001220150 5:169893638-169893660 AGGGAGAGAGCAGAAGTGGGTGG + Intronic
1001942364 5:175749864-175749886 CGTGAAAGAGCAGAGGTCACAGG + Intergenic
1001958427 5:175864361-175864383 AGGGAAGGGGCAGGGGTGGCTGG - Intronic
1002000705 5:176194941-176194963 CGGGTAAGAGCAAAGCCGGCCGG + Intergenic
1002253637 5:177944046-177944068 CGGGTAAGAGCAAAGCCGGCCGG - Intergenic
1002986154 6:2191664-2191686 CTGGAGGGAGCTGAGGTGGCAGG - Intronic
1004158998 6:13196886-13196908 TGGAAAAGAGCAGAGGTGATTGG - Intronic
1005279062 6:24251539-24251561 CTGAAAAGAGCACAGGTGTCAGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005549254 6:26897658-26897680 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1005549431 6:26898475-26898497 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1005549607 6:26899295-26899317 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1005549781 6:26900112-26900134 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1006070536 6:31495025-31495047 TGGGGCAGAGCAGAGGGGGCTGG + Intronic
1006591516 6:35161345-35161367 TGGAAAAGAGGAGAGGTGGCTGG + Intergenic
1006996237 6:38263990-38264012 AGGTAAAGAGCAGGGGTGGTGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009019996 6:57938768-57938790 CGGGAGTGGGAAGAGGTGGCAGG - Intergenic
1010108761 6:72199585-72199607 CTGGAGAGGGCAGAGGTGGAGGG + Intronic
1010412950 6:75581454-75581476 CAGGAAAGGGCAGATGTGTCAGG - Intergenic
1010426592 6:75734750-75734772 GGGGAAGGAGGAGAGGTGGAGGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013288390 6:108699482-108699504 AGGGATAAAGCAGATGTGGCGGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014818901 6:125963629-125963651 TGGGGCAGAGCAGAGGTGGCAGG + Intronic
1015509260 6:134021863-134021885 CTGGATAGAGCAGAGGCGGAAGG + Intronic
1015822989 6:137282738-137282760 GGGGAGAGTGCAGAGGTGACTGG + Intergenic
1017895287 6:158674231-158674253 CAGAAAAGAGCAGAAATGGCAGG - Intronic
1018736123 6:166688379-166688401 CGGGGATGAGCAGAGGGGGCCGG - Intronic
1018900740 6:168050569-168050591 GGGGAAAGAGCAGCGGTCGGAGG + Intergenic
1018998415 6:168727454-168727476 AGAGAGAGAGCAGAGGTGGCTGG + Intergenic
1019284478 7:216571-216593 CTGGAAAGAGCAGGGAGGGCAGG - Intronic
1019394802 7:812095-812117 CTGGAGAGAACAGAGGAGGCAGG - Intergenic
1019594767 7:1853361-1853383 CTGGAAAGAGCGGAGGTGGAGGG + Intronic
1019882568 7:3875736-3875758 CTGGAACTAGCAGAGGTGGTTGG + Intronic
1020319569 7:6929842-6929864 AGGGAGAGAGCAGAGGTCACAGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023418135 7:39950803-39950825 CCAGGAAGAGCAGAGGCGGCGGG - Exonic
1023466978 7:40466729-40466751 CAGAAAAGAGCAGTGGTAGCTGG + Intronic
1023916336 7:44592189-44592211 GGGGTGAGAGCAGAGGTGGAGGG - Intergenic
1025306993 7:57869190-57869212 CTGCAAAAAGCAGCGGTGGCGGG + Intergenic
1025561154 7:62376642-62376664 CGGGAAAAACCTGAGGCGGCGGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030067494 7:105671549-105671571 CGGGTGAGAGCAGAGGTTGCTGG - Intronic
1031076678 7:117220034-117220056 GGTGAAAGGGCAGAGATGGCAGG - Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032724708 7:134580146-134580168 AGGCAAGGAGGAGAGGTGGCAGG - Intergenic
1033037632 7:137889347-137889369 CTGGAGAGAGCAGAGAGGGCTGG + Intronic
1033148889 7:138895978-138896000 CGTGAAAGAGAAGTGGGGGCCGG - Intronic
1033936554 7:146592835-146592857 CGGGACAGTCCAGTGGTGGCAGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034274148 7:149816752-149816774 CAGGCAAGTCCAGAGGTGGCAGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035529735 8:341705-341727 CTGGAAAGTGGAGAGGAGGCTGG + Intergenic
1036567281 8:9948295-9948317 TGGGAAAGAGAAGAGGTTGGTGG - Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1042019265 8:64353079-64353101 TGGGGAAAAGCAGAGCTGGCAGG - Intergenic
1042360924 8:67882344-67882366 AGGGGAAGAGCAGAGCTGGTGGG - Intergenic
1042687920 8:71462282-71462304 CAGGAAGGAGCCAAGGTGGCAGG + Intronic
1043314498 8:78903327-78903349 AGAGAAAGAGCAGAGGTTGAGGG - Intergenic
1043737802 8:83769027-83769049 CTGGAAAGGGCCAAGGTGGCAGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1043939461 8:86180605-86180627 CTGCAGAGAGCAGAGGTGACTGG + Intergenic
1044487053 8:92766392-92766414 TGGACAACAGCAGAGGTGGCTGG + Intergenic
1045213592 8:100124517-100124539 CTGGGAACAGAAGAGGTGGCAGG + Intronic
1045370221 8:101515484-101515506 GTGGAAAGAGCAGAAATGGCAGG - Intronic
1045520225 8:102896892-102896914 AGGGACAGAGCAGAGAGGGCTGG + Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046375634 8:113376839-113376861 GGGAAAGGGGCAGAGGTGGCCGG - Intronic
1047140844 8:122137586-122137608 CGGGATAGAGCAGAGTTGCGAGG + Intergenic
1047838905 8:128726014-128726036 AGGGACAGAGAAGACGTGGCTGG + Intergenic
1048267800 8:133003040-133003062 AGGGAAAGAGGAGAGGTACCTGG - Intronic
1048565180 8:135588576-135588598 AAGGAAAGAGGAGAGGTGGCTGG - Intronic
1049201613 8:141343323-141343345 CAGGAAAGAACAGGGGGGGCTGG - Intergenic
1049442988 8:142617631-142617653 CAGGCAGGAGCAGAGGCGGCTGG - Intergenic
1050124974 9:2347484-2347506 AGGGAAAGGGCAGAGGTTGGAGG - Intergenic
1050589605 9:7148410-7148432 CGGGAAAGAGCTGTGGGGCCAGG - Intergenic
1050668593 9:7969731-7969753 AGGAAAAGAGCATAGGTGGTAGG + Intergenic
1053420009 9:37971387-37971409 AGGGAAAGTGGAGAGGTGGGTGG - Intronic
1053930012 9:43108587-43108609 AGGGGATGAGCAGAGGAGGCTGG - Intergenic
1053945879 9:43310605-43310627 CGGCAAAAAGCCGCGGTGGCAGG - Intergenic
1053946177 9:43311929-43311951 CCGCAAAAAGCAGCGGTGGCGGG - Intergenic
1053946268 9:43312311-43312333 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1055659496 9:78488614-78488636 CGGGAGAGAGGAGAGGTGCGTGG - Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056923721 9:90814582-90814604 TGGGAAAGGGGAGAGGTGGGTGG - Intronic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1058072359 9:100614352-100614374 CTGGAAAGGATAGAGGTGGCAGG - Intergenic
1058172233 9:101695578-101695600 GTGGAAAGAGAGGAGGTGGCTGG + Intronic
1058621151 9:106884538-106884560 GGGGACAGGGCAGAGGTGGATGG - Intronic
1058985702 9:110207260-110207282 TGGGGAAGAGCAGGGGAGGCGGG - Intronic
1059394784 9:114027611-114027633 CAGGAATGAGCAGAGGTGGCGGG + Intronic
1059695968 9:116730863-116730885 CAGGAATGAGCAGAGATGGAAGG - Intronic
1060180065 9:121527706-121527728 CTGGAAGGGGCTGAGGTGGCAGG - Intergenic
1060187206 9:121570955-121570977 CATGAAGGAGCAGAGGAGGCAGG - Intronic
1060197206 9:121631477-121631499 CGGGAGAGAGCAGAGGGAGGTGG + Intronic
1061404793 9:130387491-130387513 CAGAAAAGAGCAGAAGTGGTGGG + Intronic
1061509164 9:131049956-131049978 AGGGAAAGGGCAGAGCTGGTCGG - Intronic
1062240389 9:135534490-135534512 CGGGAAGGAACAGAGGAAGCAGG - Intergenic
1203589014 Un_KI270747v1:39185-39207 CGGCAAAAAGCCGCGGTGGCAGG - Intergenic
1203589307 Un_KI270747v1:40487-40509 CCGCAAAAAGCAGCGGTGGCGGG - Intergenic
1203589398 Un_KI270747v1:40869-40891 GGGGAAAAAGCCGTGGTGGCAGG - Intergenic
1187276809 X:17823548-17823570 AGGTCAAGAGCAGAGGTGGTGGG + Intronic
1187804284 X:23101069-23101091 AGCGAAGGAGCACAGGTGGCTGG - Intergenic
1190154253 X:47974966-47974988 GGGGAAGGGGCAGTGGTGGCTGG - Exonic
1190469731 X:50766295-50766317 AGGGAAAAAGTAGTGGTGGCAGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191652862 X:63560672-63560694 CGGGAATGAGAATAGGTGTCTGG - Intergenic
1192202959 X:69078523-69078545 GGGAAAAGAGCAGAGGAGGGTGG - Intergenic
1193876124 X:86864713-86864735 TGGGCAATAACAGAGGTGGCTGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196981760 X:121222024-121222046 CTGGAAAGAGCTGAGGAGGAAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198594855 X:138225071-138225093 AGGGAAAGAGCAGTGGGGTCAGG + Intergenic
1198708721 X:139478047-139478069 AGGGAAAGAGAAGAGGTGGAAGG + Intergenic
1198758514 X:140006258-140006280 AGGGAAAGTCCAGTGGTGGCGGG - Intergenic
1198780243 X:140227334-140227356 AGGGAAAGTCCAGTGGTGGCGGG + Intergenic
1199268360 X:145854358-145854380 AGGGAAAGAGCAGATGTGGGTGG - Intergenic
1200048413 X:153414990-153415012 CGGGAAACAGCAGCTGGGGCCGG + Intergenic
1200254068 X:154569970-154569992 AGGGAAAGGGCAGAGTTGGCAGG - Intergenic
1200263701 X:154634438-154634460 AGGGAAAGGGCAGAGTTGGCAGG + Intergenic
1201610419 Y:15836939-15836961 TGGGAAAGAGAAGACCTGGCTGG + Intergenic