ID: 942046987

View in Genome Browser
Species Human (GRCh38)
Location 2:172105412-172105434
Sequence TTTGTTTTACAGATAAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942046987_942046999 23 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046999 2:172105458-172105480 GGGGGCAAAGAAGAGACCAGAGG No data
942046987_942046996 3 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046996 2:172105438-172105460 TTGTGTACATGGGGGAAAGAGGG No data
942046987_942046993 -6 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046993 2:172105429-172105451 AACAAAGGATTGTGTACATGGGG No data
942046987_942046997 4 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046997 2:172105439-172105461 TGTGTACATGGGGGAAAGAGGGG No data
942046987_942046998 5 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046998 2:172105440-172105462 GTGTACATGGGGGAAAGAGGGGG No data
942046987_942046995 2 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046995 2:172105437-172105459 ATTGTGTACATGGGGGAAAGAGG No data
942046987_942046994 -5 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046994 2:172105430-172105452 ACAAAGGATTGTGTACATGGGGG No data
942046987_942046992 -7 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046992 2:172105428-172105450 AAACAAAGGATTGTGTACATGGG No data
942046987_942046991 -8 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046991 2:172105427-172105449 AAAACAAAGGATTGTGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942046987 Original CRISPR TTTGTTTTACAGATAAAGTG GGG (reversed) Intergenic
No off target data available for this crispr