ID: 942046993

View in Genome Browser
Species Human (GRCh38)
Location 2:172105429-172105451
Sequence AACAAAGGATTGTGTACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942046989_942046993 -8 Left 942046989 2:172105414-172105436 CCACTTTATCTGTAAAACAAAGG No data
Right 942046993 2:172105429-172105451 AACAAAGGATTGTGTACATGGGG No data
942046987_942046993 -6 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046993 2:172105429-172105451 AACAAAGGATTGTGTACATGGGG No data
942046988_942046993 -7 Left 942046988 2:172105413-172105435 CCCACTTTATCTGTAAAACAAAG No data
Right 942046993 2:172105429-172105451 AACAAAGGATTGTGTACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942046993 Original CRISPR AACAAAGGATTGTGTACATG GGG Intergenic
No off target data available for this crispr