ID: 942046999

View in Genome Browser
Species Human (GRCh38)
Location 2:172105458-172105480
Sequence GGGGGCAAAGAAGAGACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942046989_942046999 21 Left 942046989 2:172105414-172105436 CCACTTTATCTGTAAAACAAAGG No data
Right 942046999 2:172105458-172105480 GGGGGCAAAGAAGAGACCAGAGG No data
942046987_942046999 23 Left 942046987 2:172105412-172105434 CCCCACTTTATCTGTAAAACAAA No data
Right 942046999 2:172105458-172105480 GGGGGCAAAGAAGAGACCAGAGG No data
942046988_942046999 22 Left 942046988 2:172105413-172105435 CCCACTTTATCTGTAAAACAAAG No data
Right 942046999 2:172105458-172105480 GGGGGCAAAGAAGAGACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942046999 Original CRISPR GGGGGCAAAGAAGAGACCAG AGG Intergenic
No off target data available for this crispr