ID: 942047495

View in Genome Browser
Species Human (GRCh38)
Location 2:172108312-172108334
Sequence GACTCGAGCCTCTGCGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942047490_942047495 -3 Left 942047490 2:172108292-172108314 CCCGGGAAGATTCCTGAACAGAC No data
Right 942047495 2:172108312-172108334 GACTCGAGCCTCTGCGGAGAGGG No data
942047484_942047495 21 Left 942047484 2:172108268-172108290 CCGCCCGGCTGCGCAGAGGGTAG No data
Right 942047495 2:172108312-172108334 GACTCGAGCCTCTGCGGAGAGGG No data
942047483_942047495 22 Left 942047483 2:172108267-172108289 CCCGCCCGGCTGCGCAGAGGGTA No data
Right 942047495 2:172108312-172108334 GACTCGAGCCTCTGCGGAGAGGG No data
942047489_942047495 -2 Left 942047489 2:172108291-172108313 CCCCGGGAAGATTCCTGAACAGA No data
Right 942047495 2:172108312-172108334 GACTCGAGCCTCTGCGGAGAGGG No data
942047491_942047495 -4 Left 942047491 2:172108293-172108315 CCGGGAAGATTCCTGAACAGACT No data
Right 942047495 2:172108312-172108334 GACTCGAGCCTCTGCGGAGAGGG No data
942047486_942047495 17 Left 942047486 2:172108272-172108294 CCGGCTGCGCAGAGGGTAGCCCC No data
Right 942047495 2:172108312-172108334 GACTCGAGCCTCTGCGGAGAGGG No data
942047485_942047495 18 Left 942047485 2:172108271-172108293 CCCGGCTGCGCAGAGGGTAGCCC No data
Right 942047495 2:172108312-172108334 GACTCGAGCCTCTGCGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942047495 Original CRISPR GACTCGAGCCTCTGCGGAGA GGG Intergenic
No off target data available for this crispr