ID: 942059607

View in Genome Browser
Species Human (GRCh38)
Location 2:172215836-172215858
Sequence AGGTCTCGTCCAGTACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942059607_942059609 -2 Left 942059607 2:172215836-172215858 CCAGCAGGTACTGGACGAGACCT No data
Right 942059609 2:172215857-172215879 CTCAGAGACTCAGCCTCCTCAGG No data
942059607_942059610 7 Left 942059607 2:172215836-172215858 CCAGCAGGTACTGGACGAGACCT No data
Right 942059610 2:172215866-172215888 TCAGCCTCCTCAGGCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942059607 Original CRISPR AGGTCTCGTCCAGTACCTGC TGG (reversed) Intergenic
No off target data available for this crispr