ID: 942060585

View in Genome Browser
Species Human (GRCh38)
Location 2:172225317-172225339
Sequence CTGTCATAAGGACTGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942060585_942060591 -5 Left 942060585 2:172225317-172225339 CCATCCCCCAGTCCTTATGACAG No data
Right 942060591 2:172225335-172225357 GACAGTGTGCTAAATCCGAGAGG No data
942060585_942060592 7 Left 942060585 2:172225317-172225339 CCATCCCCCAGTCCTTATGACAG No data
Right 942060592 2:172225347-172225369 AATCCGAGAGGAAAAACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942060585 Original CRISPR CTGTCATAAGGACTGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr