ID: 942061754

View in Genome Browser
Species Human (GRCh38)
Location 2:172234300-172234322
Sequence CTGGGTGAAACAAGGGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942061748_942061754 -1 Left 942061748 2:172234278-172234300 CCGGGGAGAGGAATTTCTTCTCC No data
Right 942061754 2:172234300-172234322 CTGGGTGAAACAAGGGATGTAGG No data
942061743_942061754 30 Left 942061743 2:172234247-172234269 CCTGGAGACTGGTGAGTAGCTCT No data
Right 942061754 2:172234300-172234322 CTGGGTGAAACAAGGGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942061754 Original CRISPR CTGGGTGAAACAAGGGATGT AGG Intergenic
No off target data available for this crispr