ID: 942062044

View in Genome Browser
Species Human (GRCh38)
Location 2:172236393-172236415
Sequence CACCACCATAATCAAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942062043_942062044 28 Left 942062043 2:172236342-172236364 CCATTCTCATGCACAAGTCAATG No data
Right 942062044 2:172236393-172236415 CACCACCATAATCAAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942062044 Original CRISPR CACCACCATAATCAAGACAC AGG Intergenic
No off target data available for this crispr