ID: 942064258

View in Genome Browser
Species Human (GRCh38)
Location 2:172255324-172255346
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942064258_942064269 8 Left 942064258 2:172255324-172255346 CCTCTTAACCTCCTCCACCCCAC No data
Right 942064269 2:172255355-172255377 TCTCCAGAAGCAATCACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942064258 Original CRISPR GTGGGGTGGAGGAGGTTAAG AGG (reversed) Intergenic
No off target data available for this crispr