ID: 942069903

View in Genome Browser
Species Human (GRCh38)
Location 2:172306824-172306846
Sequence GGAGTCCAGGGTGGCTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942069903_942069910 16 Left 942069903 2:172306824-172306846 CCACTCCAGCCACCCTGGACTCC No data
Right 942069910 2:172306863-172306885 ATGTCCAGTCTTTACAGCCCTGG No data
942069903_942069911 17 Left 942069903 2:172306824-172306846 CCACTCCAGCCACCCTGGACTCC No data
Right 942069911 2:172306864-172306886 TGTCCAGTCTTTACAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942069903 Original CRISPR GGAGTCCAGGGTGGCTGGAG TGG (reversed) Intergenic