ID: 942071956

View in Genome Browser
Species Human (GRCh38)
Location 2:172324338-172324360
Sequence TACTCATCGCAGGTTTCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942071956_942071959 8 Left 942071956 2:172324338-172324360 CCAGTAGAAACCTGCGATGAGTA No data
Right 942071959 2:172324369-172324391 CAGCGAGGCTGAGACTTTCCAGG No data
942071956_942071958 -7 Left 942071956 2:172324338-172324360 CCAGTAGAAACCTGCGATGAGTA No data
Right 942071958 2:172324354-172324376 ATGAGTACATGAAATCAGCGAGG No data
942071956_942071962 25 Left 942071956 2:172324338-172324360 CCAGTAGAAACCTGCGATGAGTA No data
Right 942071962 2:172324386-172324408 TCCAGGAAACAGACTCAGGGAGG No data
942071956_942071961 22 Left 942071956 2:172324338-172324360 CCAGTAGAAACCTGCGATGAGTA No data
Right 942071961 2:172324383-172324405 CTTTCCAGGAAACAGACTCAGGG No data
942071956_942071960 21 Left 942071956 2:172324338-172324360 CCAGTAGAAACCTGCGATGAGTA No data
Right 942071960 2:172324382-172324404 ACTTTCCAGGAAACAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942071956 Original CRISPR TACTCATCGCAGGTTTCTAC TGG (reversed) Intergenic
No off target data available for this crispr