ID: 942071962

View in Genome Browser
Species Human (GRCh38)
Location 2:172324386-172324408
Sequence TCCAGGAAACAGACTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942071957_942071962 15 Left 942071957 2:172324348-172324370 CCTGCGATGAGTACATGAAATCA No data
Right 942071962 2:172324386-172324408 TCCAGGAAACAGACTCAGGGAGG No data
942071955_942071962 26 Left 942071955 2:172324337-172324359 CCCAGTAGAAACCTGCGATGAGT No data
Right 942071962 2:172324386-172324408 TCCAGGAAACAGACTCAGGGAGG No data
942071956_942071962 25 Left 942071956 2:172324338-172324360 CCAGTAGAAACCTGCGATGAGTA No data
Right 942071962 2:172324386-172324408 TCCAGGAAACAGACTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942071962 Original CRISPR TCCAGGAAACAGACTCAGGG AGG Intergenic
No off target data available for this crispr