ID: 942074068

View in Genome Browser
Species Human (GRCh38)
Location 2:172340816-172340838
Sequence CATTTTATTTAGAAATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942074066_942074068 7 Left 942074066 2:172340786-172340808 CCCTACTGGATAACTCAATAGCA No data
Right 942074068 2:172340816-172340838 CATTTTATTTAGAAATTTGAAGG No data
942074064_942074068 30 Left 942074064 2:172340763-172340785 CCTAATGGGAAGCTTATTGATGT No data
Right 942074068 2:172340816-172340838 CATTTTATTTAGAAATTTGAAGG No data
942074067_942074068 6 Left 942074067 2:172340787-172340809 CCTACTGGATAACTCAATAGCAG No data
Right 942074068 2:172340816-172340838 CATTTTATTTAGAAATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942074068 Original CRISPR CATTTTATTTAGAAATTTGA AGG Intergenic
No off target data available for this crispr