ID: 942078738

View in Genome Browser
Species Human (GRCh38)
Location 2:172380970-172380992
Sequence AGCATTCACCAGAATCGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942078738_942078741 21 Left 942078738 2:172380970-172380992 CCCAGGCGATTCTGGTGAATGCT No data
Right 942078741 2:172381014-172381036 TATAGAATCTCCATAGAACCAGG No data
942078738_942078744 29 Left 942078738 2:172380970-172380992 CCCAGGCGATTCTGGTGAATGCT No data
Right 942078744 2:172381022-172381044 CTCCATAGAACCAGGAAGGAGGG No data
942078738_942078742 25 Left 942078738 2:172380970-172380992 CCCAGGCGATTCTGGTGAATGCT No data
Right 942078742 2:172381018-172381040 GAATCTCCATAGAACCAGGAAGG No data
942078738_942078743 28 Left 942078738 2:172380970-172380992 CCCAGGCGATTCTGGTGAATGCT No data
Right 942078743 2:172381021-172381043 TCTCCATAGAACCAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942078738 Original CRISPR AGCATTCACCAGAATCGCCT GGG (reversed) Intergenic
No off target data available for this crispr