ID: 942078740

View in Genome Browser
Species Human (GRCh38)
Location 2:172380996-172381018
Sequence CTATATGAGAATTTAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942078740_942078744 3 Left 942078740 2:172380996-172381018 CCTTGTTCTAAATTCTCATATAG No data
Right 942078744 2:172381022-172381044 CTCCATAGAACCAGGAAGGAGGG No data
942078740_942078741 -5 Left 942078740 2:172380996-172381018 CCTTGTTCTAAATTCTCATATAG No data
Right 942078741 2:172381014-172381036 TATAGAATCTCCATAGAACCAGG No data
942078740_942078743 2 Left 942078740 2:172380996-172381018 CCTTGTTCTAAATTCTCATATAG No data
Right 942078743 2:172381021-172381043 TCTCCATAGAACCAGGAAGGAGG No data
942078740_942078747 15 Left 942078740 2:172380996-172381018 CCTTGTTCTAAATTCTCATATAG No data
Right 942078747 2:172381034-172381056 AGGAAGGAGGGAGAGATCTGAGG No data
942078740_942078742 -1 Left 942078740 2:172380996-172381018 CCTTGTTCTAAATTCTCATATAG No data
Right 942078742 2:172381018-172381040 GAATCTCCATAGAACCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942078740 Original CRISPR CTATATGAGAATTTAGAACA AGG (reversed) Intergenic