ID: 942078741

View in Genome Browser
Species Human (GRCh38)
Location 2:172381014-172381036
Sequence TATAGAATCTCCATAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942078740_942078741 -5 Left 942078740 2:172380996-172381018 CCTTGTTCTAAATTCTCATATAG No data
Right 942078741 2:172381014-172381036 TATAGAATCTCCATAGAACCAGG No data
942078739_942078741 20 Left 942078739 2:172380971-172380993 CCAGGCGATTCTGGTGAATGCTG No data
Right 942078741 2:172381014-172381036 TATAGAATCTCCATAGAACCAGG No data
942078738_942078741 21 Left 942078738 2:172380970-172380992 CCCAGGCGATTCTGGTGAATGCT No data
Right 942078741 2:172381014-172381036 TATAGAATCTCCATAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942078741 Original CRISPR TATAGAATCTCCATAGAACC AGG Intergenic
No off target data available for this crispr