ID: 942082247

View in Genome Browser
Species Human (GRCh38)
Location 2:172411250-172411272
Sequence AGTCCTGGAGATAGACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942082247_942082251 4 Left 942082247 2:172411250-172411272 CCTGGATGTCTATCTCCAGGACT No data
Right 942082251 2:172411277-172411299 AGTTCTGGGTCTTCTTTTGCAGG No data
942082247_942082249 -10 Left 942082247 2:172411250-172411272 CCTGGATGTCTATCTCCAGGACT No data
Right 942082249 2:172411263-172411285 CTCCAGGACTAAGAAGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942082247 Original CRISPR AGTCCTGGAGATAGACATCC AGG (reversed) Intergenic
No off target data available for this crispr