ID: 942082392

View in Genome Browser
Species Human (GRCh38)
Location 2:172412966-172412988
Sequence AAATCTTGGCAGCTTGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942082387_942082392 -9 Left 942082387 2:172412952-172412974 CCAAGCACCACCAGAAATCTTGG No data
Right 942082392 2:172412966-172412988 AAATCTTGGCAGCTTGGCACAGG No data
942082386_942082392 11 Left 942082386 2:172412932-172412954 CCTTGTGGACTACAATGGAACCA No data
Right 942082392 2:172412966-172412988 AAATCTTGGCAGCTTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942082392 Original CRISPR AAATCTTGGCAGCTTGGCAC AGG Intergenic