ID: 942082769

View in Genome Browser
Species Human (GRCh38)
Location 2:172416924-172416946
Sequence CTGTGGAAGTAAAGCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942082769_942082775 5 Left 942082769 2:172416924-172416946 CCAAGATAGCTTTACTTCCACAG No data
Right 942082775 2:172416952-172416974 GCCTGGACAGCTAGAAGGATGGG No data
942082769_942082774 4 Left 942082769 2:172416924-172416946 CCAAGATAGCTTTACTTCCACAG No data
Right 942082774 2:172416951-172416973 GGCCTGGACAGCTAGAAGGATGG No data
942082769_942082777 14 Left 942082769 2:172416924-172416946 CCAAGATAGCTTTACTTCCACAG No data
Right 942082777 2:172416961-172416983 GCTAGAAGGATGGGCTCAGTTGG No data
942082769_942082773 0 Left 942082769 2:172416924-172416946 CCAAGATAGCTTTACTTCCACAG No data
Right 942082773 2:172416947-172416969 TCTTGGCCTGGACAGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942082769 Original CRISPR CTGTGGAAGTAAAGCTATCT TGG (reversed) Intergenic
No off target data available for this crispr