ID: 942084139

View in Genome Browser
Species Human (GRCh38)
Location 2:172428262-172428284
Sequence GTCCCAGCAAACACGCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942084139_942084149 23 Left 942084139 2:172428262-172428284 CCTCCGGGCGTGTTTGCTGGGAC No data
Right 942084149 2:172428308-172428330 GAGCTTCACGTGTGTGTTTGGGG No data
942084139_942084152 29 Left 942084139 2:172428262-172428284 CCTCCGGGCGTGTTTGCTGGGAC No data
Right 942084152 2:172428314-172428336 CACGTGTGTGTTTGGGGCTGGGG No data
942084139_942084148 22 Left 942084139 2:172428262-172428284 CCTCCGGGCGTGTTTGCTGGGAC No data
Right 942084148 2:172428307-172428329 TGAGCTTCACGTGTGTGTTTGGG No data
942084139_942084150 27 Left 942084139 2:172428262-172428284 CCTCCGGGCGTGTTTGCTGGGAC No data
Right 942084150 2:172428312-172428334 TTCACGTGTGTGTTTGGGGCTGG No data
942084139_942084147 21 Left 942084139 2:172428262-172428284 CCTCCGGGCGTGTTTGCTGGGAC No data
Right 942084147 2:172428306-172428328 CTGAGCTTCACGTGTGTGTTTGG No data
942084139_942084151 28 Left 942084139 2:172428262-172428284 CCTCCGGGCGTGTTTGCTGGGAC No data
Right 942084151 2:172428313-172428335 TCACGTGTGTGTTTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942084139 Original CRISPR GTCCCAGCAAACACGCCCGG AGG (reversed) Intronic
No off target data available for this crispr