ID: 942087234

View in Genome Browser
Species Human (GRCh38)
Location 2:172454836-172454858
Sequence CTGGCTTTACAGATGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942087227_942087234 27 Left 942087227 2:172454786-172454808 CCCAGTGGTTCTTGTAATGTGGA No data
Right 942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG No data
942087228_942087234 26 Left 942087228 2:172454787-172454809 CCAGTGGTTCTTGTAATGTGGAA No data
Right 942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942087234 Original CRISPR CTGGCTTTACAGATGAAAGA AGG Intronic
No off target data available for this crispr