ID: 942087590

View in Genome Browser
Species Human (GRCh38)
Location 2:172457889-172457911
Sequence ATGAAGAAGCAGAAAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942087587_942087590 6 Left 942087587 2:172457860-172457882 CCTCAAGGCTCCCTAATAGTTTA No data
Right 942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG No data
942087589_942087590 -5 Left 942087589 2:172457871-172457893 CCTAATAGTTTAGAGATTATGAA No data
Right 942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG No data
942087588_942087590 -4 Left 942087588 2:172457870-172457892 CCCTAATAGTTTAGAGATTATGA No data
Right 942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG No data
942087586_942087590 13 Left 942087586 2:172457853-172457875 CCTGGCTCCTCAAGGCTCCCTAA No data
Right 942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942087590 Original CRISPR ATGAAGAAGCAGAAAGCAGA TGG Intronic
No off target data available for this crispr