ID: 942088561

View in Genome Browser
Species Human (GRCh38)
Location 2:172465539-172465561
Sequence GTTGCTCGTGGGGGCCCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942088554_942088561 3 Left 942088554 2:172465513-172465535 CCAAATTGTCTCTGTTTCATCAA 0: 1
1: 0
2: 3
3: 34
4: 335
Right 942088561 2:172465539-172465561 GTTGCTCGTGGGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942088561 Original CRISPR GTTGCTCGTGGGGGCCCCGC GGG Exonic
901628014 1:10634590-10634612 GTTGCTGGTGGCGCCCCTGCTGG + Intergenic
903674502 1:25055560-25055582 GTTGCCTGTGGGGGTCCTGCTGG - Intergenic
914490081 1:148146347-148146369 GTTGTTGGCGGGGGCCCCGGTGG + Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
918275863 1:182953234-182953256 GCTGCTCGAGGGCGTCCCGCCGG + Exonic
919930554 1:202218641-202218663 GTTACTTGTGGGGGCTCCGTTGG - Intronic
1066654623 10:37686619-37686641 GTTGCACCTGGGGGCCCAGAAGG + Intergenic
1069615275 10:69802751-69802773 GCTGCGCGAGGGGGCGCCGCGGG - Intronic
1070835177 10:79443486-79443508 GGTGCTTGTGGGAGCCCCACGGG - Intronic
1070864631 10:79700489-79700511 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1070878421 10:79838619-79838641 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1071631534 10:87222718-87222740 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1071644976 10:87354930-87354952 TTTCCTAGTGGGGGCCCTGCGGG - Intergenic
1076531351 10:131147445-131147467 CTTGCTCGTGGGGACAGCGCGGG - Intronic
1076706904 10:132307360-132307382 GTTTCTAGTGGCGGCGCCGCAGG - Intronic
1085402036 11:76241227-76241249 GTTGCACATGGGGGCCCAGCTGG - Intergenic
1101570641 12:105950546-105950568 GTTGCTCCCGAGGGCCCCTCTGG - Intergenic
1102986712 12:117284360-117284382 GTGGCTGGTGGCGGCCACGCTGG - Intronic
1104211635 12:126694292-126694314 GGTGCTCATGGGGGCCCCGAAGG - Intergenic
1108974161 13:56417210-56417232 GTTGCACCTGGGGGCCTCACAGG + Intergenic
1113526239 13:110980103-110980125 GATGCTCTTGGGGGCCTTGCAGG + Intergenic
1113539497 13:111095216-111095238 GTTGCTGGTGGGGCCTCCGGAGG + Intergenic
1114656207 14:24316982-24317004 GGTGCTCGTGGGCGCCCTGGTGG + Exonic
1114752786 14:25224347-25224369 GTTGATCTTACGGGCCCCGCAGG + Intergenic
1122278039 14:100605278-100605300 GCTGCTCTTTGGGGCCCTGCTGG - Intergenic
1125448386 15:39782631-39782653 GTTCCTCGAGGAGGCCCGGCGGG - Exonic
1125685201 15:41559553-41559575 GTTGGGGGTGGGGGCCCGGCCGG - Intronic
1128520041 15:68369262-68369284 GCTGGTCGTGGGCGCCCCACTGG - Exonic
1132523237 16:401108-401130 GTTCCGCGTGGGGGCCCGGGCGG - Intronic
1134561707 16:15215627-15215649 GATGCTGGAGCGGGCCCCGCAGG - Intergenic
1134922245 16:18127253-18127275 GATGCTGGAGCGGGCCCCGCAGG - Intergenic
1135653667 16:24228660-24228682 GTTGTCTTTGGGGGCCCCGCAGG - Intergenic
1143385279 17:6525663-6525685 GTTGCACGTGGAGGCCCAGTAGG - Intronic
1143724036 17:8833151-8833173 GCTGCCCCTGGGGGCCCGGCAGG + Intronic
1145190684 17:20840999-20841021 GTTGTTGGCGGGGGCCCCGGTGG + Intronic
1149772396 17:59331963-59331985 GTTCCGCGTGGGGTCCCCGTGGG + Intronic
1152276959 17:79363577-79363599 GTTGCTCGCGGAGACCCCCCAGG - Intronic
1152579445 17:81159668-81159690 GGTGCTCGGTGGGGCCCCTCTGG - Intronic
1152905478 17:82968317-82968339 GTTGCTGGTGAGGGCTCCACTGG - Intronic
1156369100 18:36456643-36456665 GTTGCCCGTGGGGGACACACAGG - Intronic
1160497205 18:79382703-79382725 GATGCTCGTGTGGACCCTGCAGG + Intergenic
1160860586 19:1235843-1235865 GCTGTTCGTGGGGGGCACGCTGG - Exonic
1160995823 19:1881592-1881614 GTTGTTGGCGGGGGCCCCGGTGG - Exonic
1161367762 19:3890784-3890806 GTAGCTCGTGGGGGCCAGGCTGG - Intronic
1161839393 19:6669916-6669938 GTTGCTGATGGGGGCCGGGCTGG - Exonic
1162068507 19:8139939-8139961 CTTGCACCTGGGGGCCCCCCAGG + Intronic
1162874416 19:13610167-13610189 TTTGGTCATGGGGCCCCCGCAGG - Intronic
1163289003 19:16366282-16366304 GTCGCTCTTGGGGGCCTGGCTGG - Intronic
1164950184 19:32330599-32330621 TTTGCTCTTGGGCGCTCCGCTGG + Intergenic
1166194838 19:41198741-41198763 GCTGCTTGTGGGGGCCTGGCAGG - Exonic
1168474931 19:56668819-56668841 CTTGCTGGTGGGGGCCAGGCTGG + Intronic
928186396 2:29115173-29115195 GCAGCTGGTGGGGGCGCCGCAGG + Intronic
933128478 2:78642330-78642352 CTTGCTCGTGGGGGCTCCGTAGG - Intergenic
936125709 2:109787711-109787733 GTGGCAGGTGGGGGACCCGCAGG - Intergenic
936218984 2:110583757-110583779 GTGGCAGGTGGGGGACCCGCAGG + Intergenic
938061803 2:128260929-128260951 GTTGCTCGTGAGGGCTGAGCGGG - Intronic
940987286 2:160062352-160062374 GCTGCTGCTGGGGGCGCCGCGGG - Exonic
942088561 2:172465539-172465561 GTTGCTCGTGGGGGCCCCGCGGG + Exonic
948184149 2:236006167-236006189 GTGGCTCCTGGGGGCTCCTCTGG + Intronic
948981117 2:241495370-241495392 GTAGCTCATGAGGGCCACGCCGG + Exonic
1171253280 20:23666881-23666903 ATTGCTGGTGGGGGCTCTGCTGG + Intergenic
1173079340 20:39850868-39850890 GCTGCTCAGGGGTGCCCCGCTGG - Intergenic
1181121603 22:20671010-20671032 GTTGTTGGCGGGGGCCCCGGTGG - Intergenic
1181334565 22:22118031-22118053 GTTGTTGGCGGGGGCCCCGGTGG - Intergenic
1182122607 22:27797477-27797499 GTTGCTCCTGGGGGATCAGCCGG - Exonic
1182547706 22:31085382-31085404 GTTGCCCATGGGGGTCCCGCCGG - Intronic
1183126449 22:35786532-35786554 GTGACTGGTGGGGGCCCCCCAGG - Intronic
961827449 3:129606510-129606532 GCTGCTCCTGGGGGCGGCGCGGG - Exonic
968486871 4:867107-867129 GTTGCTGGAGGGGGCCTTGCAGG + Exonic
968942078 4:3644119-3644141 GCTGCCCCTGGGGGCTCCGCGGG - Intergenic
969394062 4:6909524-6909546 GATGTCCGTGGGGGCCCTGCGGG + Intronic
983061448 4:163166259-163166281 GTTGCTTGTGTGGGCCCTGGAGG - Intronic
986369899 5:7069530-7069552 GCTCCACGTGGGGGCCCCTCTGG - Intergenic
992374621 5:76176048-76176070 ATTGCTCCTGGGGGCCTGGCTGG - Intronic
995492467 5:112707579-112707601 GCTGCTCGGGGGGGACCTGCGGG + Intronic
1002259637 5:177984467-177984489 ATTGCACCTGGCGGCCCCGCGGG - Intergenic
1002534065 5:179866473-179866495 GTGGCTGGTGGGGGCACCTCAGG + Intronic
1002785797 6:398948-398970 TTTGCTCCTGGAGGCACCGCAGG + Intronic
1016531018 6:145058250-145058272 GATGCTGGTGGGAGCCCTGCAGG - Intergenic
1018635356 6:165855157-165855179 GTAGCTGCTGTGGGCCCCGCGGG - Intronic
1019216516 6:170447360-170447382 GCTGCTGGTGCGGGCCCTGCCGG + Intergenic
1023192440 7:37597146-37597168 GTTGCTCCAGGGGGCCTCACTGG - Intergenic
1024076126 7:45818746-45818768 GTGGCTCCAGGGGGCCGCGCAGG + Intergenic
1047499501 8:125430706-125430728 GTTGCACGCGGGGACCACGCTGG - Exonic
1049175585 8:141190586-141190608 GCTGCTCCTGGGGGCTCCCCAGG + Intronic
1049189537 8:141279170-141279192 GATGCTCGTGGGAGCCCCTGTGG + Intronic
1049403850 8:142442962-142442984 GTTTCCTGTGGGGGCCCCGGGGG - Intergenic
1049462765 8:142737690-142737712 GTGGCTCGTGGGGTCGCCACAGG + Intergenic
1049813606 8:144587614-144587636 CTTCCTCGTGGGGACCCAGCAGG - Intronic
1061362930 9:130155201-130155223 CTTGCTGGTGGGGTCCCCTCAGG + Intergenic
1061797872 9:133098793-133098815 GATGCTCCTGGGGGCCCTGCAGG + Intronic
1062513715 9:136921737-136921759 GGTGCTCGTGGGGTCTCCCCTGG + Intronic
1185504819 X:624295-624317 TTGGCTCCTGGGGGCCCCCCAGG - Intergenic
1185544825 X:935153-935175 TTTGCTCTTAGGGGCCCCGGAGG - Intergenic
1193620689 X:83749960-83749982 GGTGCAGGTGGGGGCCCCCCAGG - Intergenic
1194977368 X:100408806-100408828 GGGGCTCGCGGGGGCCCCGGGGG + Exonic