ID: 942093146

View in Genome Browser
Species Human (GRCh38)
Location 2:172513536-172513558
Sequence TCCGCAGCTGGTGCCCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942093142_942093146 8 Left 942093142 2:172513505-172513527 CCGTTGTTGGGTCAGGGTCTGTG No data
Right 942093146 2:172513536-172513558 TCCGCAGCTGGTGCCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942093146 Original CRISPR TCCGCAGCTGGTGCCCTGTG TGG Intergenic
No off target data available for this crispr