ID: 942093638

View in Genome Browser
Species Human (GRCh38)
Location 2:172517778-172517800
Sequence TATAACTTATACACAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942093638_942093644 21 Left 942093638 2:172517778-172517800 CCTCCCACTGTGTATAAGTTATA No data
Right 942093644 2:172517822-172517844 TACCTGCCCAAAAACAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942093638 Original CRISPR TATAACTTATACACAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr