ID: 942095835

View in Genome Browser
Species Human (GRCh38)
Location 2:172535784-172535806
Sequence CTACAAGGATGGAAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942095824_942095835 27 Left 942095824 2:172535734-172535756 CCATATTGGGACCCATGGGCAGC No data
Right 942095835 2:172535784-172535806 CTACAAGGATGGAAGAAAAAAGG No data
942095825_942095835 16 Left 942095825 2:172535745-172535767 CCCATGGGCAGCACCTGTCAAGG No data
Right 942095835 2:172535784-172535806 CTACAAGGATGGAAGAAAAAAGG No data
942095827_942095835 15 Left 942095827 2:172535746-172535768 CCATGGGCAGCACCTGTCAAGGT No data
Right 942095835 2:172535784-172535806 CTACAAGGATGGAAGAAAAAAGG No data
942095829_942095835 3 Left 942095829 2:172535758-172535780 CCTGTCAAGGTTGGTGAAACGTG No data
Right 942095835 2:172535784-172535806 CTACAAGGATGGAAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942095835 Original CRISPR CTACAAGGATGGAAGAAAAA AGG Intergenic
No off target data available for this crispr