ID: 942098333

View in Genome Browser
Species Human (GRCh38)
Location 2:172554966-172554988
Sequence CCCCTTGGGCACGTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2645
Summary {0: 3, 1: 29, 2: 483, 3: 849, 4: 1281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942098327_942098333 1 Left 942098327 2:172554942-172554964 CCCTGTATAAAACCAAGCTGTTC 0: 1
1: 1
2: 1
3: 12
4: 159
Right 942098333 2:172554966-172554988 CCCCTTGGGCACGTGTTCTCAGG 0: 3
1: 29
2: 483
3: 849
4: 1281
942098326_942098333 8 Left 942098326 2:172554935-172554957 CCTGTCTCCCTGTATAAAACCAA 0: 1
1: 0
2: 1
3: 18
4: 190
Right 942098333 2:172554966-172554988 CCCCTTGGGCACGTGTTCTCAGG 0: 3
1: 29
2: 483
3: 849
4: 1281
942098328_942098333 0 Left 942098328 2:172554943-172554965 CCTGTATAAAACCAAGCTGTTCA 0: 1
1: 0
2: 1
3: 10
4: 126
Right 942098333 2:172554966-172554988 CCCCTTGGGCACGTGTTCTCAGG 0: 3
1: 29
2: 483
3: 849
4: 1281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942098333 Original CRISPR CCCCTTGGGCACGTGTTCTC AGG Intergenic
Too many off-targets to display for this crispr