ID: 942098585

View in Genome Browser
Species Human (GRCh38)
Location 2:172556336-172556358
Sequence GGCCGCACTCACCGAAGTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942098585_942098594 8 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098594 2:172556367-172556389 TGGGCCTTTTTGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 36
942098585_942098598 13 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098598 2:172556372-172556394 CTTTTTGCGCGGTCCCGGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 37
942098585_942098595 9 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098595 2:172556368-172556390 GGGCCTTTTTGCGCGGTCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 46
942098585_942098592 2 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098592 2:172556361-172556383 GGACCTTGGGCCTTTTTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 95
942098585_942098597 12 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098597 2:172556371-172556393 CCTTTTTGCGCGGTCCCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 18
942098585_942098600 22 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098600 2:172556381-172556403 CGGTCCCGGGCGGGGAGCTGCGG 0: 1
1: 0
2: 3
3: 25
4: 294
942098585_942098599 14 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098599 2:172556373-172556395 TTTTTGCGCGGTCCCGGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942098585 Original CRISPR GGCCGCACTCACCGAAGTCC AGG (reversed) Exonic