ID: 942098585

View in Genome Browser
Species Human (GRCh38)
Location 2:172556336-172556358
Sequence GGCCGCACTCACCGAAGTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942098585_942098600 22 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098600 2:172556381-172556403 CGGTCCCGGGCGGGGAGCTGCGG 0: 1
1: 0
2: 3
3: 25
4: 294
942098585_942098598 13 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098598 2:172556372-172556394 CTTTTTGCGCGGTCCCGGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 37
942098585_942098594 8 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098594 2:172556367-172556389 TGGGCCTTTTTGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 36
942098585_942098599 14 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098599 2:172556373-172556395 TTTTTGCGCGGTCCCGGGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 17
942098585_942098597 12 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098597 2:172556371-172556393 CCTTTTTGCGCGGTCCCGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 18
942098585_942098592 2 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098592 2:172556361-172556383 GGACCTTGGGCCTTTTTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 95
942098585_942098595 9 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098595 2:172556368-172556390 GGGCCTTTTTGCGCGGTCCCGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942098585 Original CRISPR GGCCGCACTCACCGAAGTCC AGG (reversed) Exonic
900632991 1:3647633-3647655 GGCCACAGTCACTGAAGGCCAGG - Intronic
901714773 1:11144578-11144600 GGGGGCACTCACCCAGGTCCTGG + Intronic
902159149 1:14515572-14515594 GGCCTCACTCACTGAGCTCCAGG + Intergenic
904044958 1:27603385-27603407 GGCGCCACTCACCGGAGTGCTGG + Exonic
904636252 1:31883977-31883999 GGGCCCACTCAGCGAAGACCAGG + Intergenic
914196209 1:145449330-145449352 GCCCGCACTCCCGGAGGTCCTGG + Intergenic
917531566 1:175840751-175840773 GGCCCCACTCACCCAATTCTTGG - Intergenic
920723477 1:208411814-208411836 GGCAGCATTCACTGATGTCCTGG - Intergenic
922726435 1:227925085-227925107 GGCAGCACTCAGGGAGGTCCCGG + Intronic
1072193728 10:93097148-93097170 AGCTGTACTCACCAAAGTCCAGG + Intergenic
1074055972 10:109923253-109923275 GGCCGCGCTCGCCGGAGCCCCGG - Intronic
1075532760 10:123243964-123243986 GGCTGGACTCACCAATGTCCAGG - Intergenic
1075630913 10:124000173-124000195 GCCCGCACTCACCTCAGCCCTGG - Intergenic
1076895356 10:133308811-133308833 GCCAGGACTCACCGCAGTCCCGG + Exonic
1080230742 11:30016325-30016347 GGGCGCACTCACCGCATCCCCGG + Intronic
1084960573 11:72714140-72714162 TGCAGCACTCACCGAACTCTGGG + Exonic
1087785299 11:102347366-102347388 AGCAGCACTCACCGCAGTGCGGG - Exonic
1093158952 12:15722256-15722278 GGCCGCACTCAAAGCTGTCCTGG + Intronic
1094178404 12:27565278-27565300 GGCAGCACTCATTGGAGTCCGGG + Intronic
1096004419 12:48157447-48157469 GACCGCACTCACCGAATTGCTGG + Exonic
1096215340 12:49795242-49795264 GGCCCCACTGACCCAAGTCAGGG - Exonic
1096843138 12:54391132-54391154 GGCCGCAGTCACCGCGGTGCCGG + Intronic
1113302483 13:109037281-109037303 GGCGGCCCTCAGTGAAGTCCAGG + Intronic
1119261319 14:73239822-73239844 GACCGCACTCACCGAGGACCCGG - Exonic
1120694982 14:87634611-87634633 GGACCCACTCACCCAGGTCCAGG + Intergenic
1122066230 14:99175908-99175930 GGCGGCCCTCGCCGAAGCCCGGG + Exonic
1128361478 15:66964771-66964793 GGCCTCAGTCACAGATGTCCTGG - Intergenic
1131255746 15:90860843-90860865 GGCCCCTCTCCCTGAAGTCCTGG - Intergenic
1132765380 16:1531792-1531814 GGCAGCACCCCCAGAAGTCCTGG - Intronic
1134236391 16:12469614-12469636 GGCAGCATTCACTGAAGGCCCGG + Intronic
1139409935 16:66751261-66751283 GCCGGCGCTCACCGAAGACCAGG + Exonic
1141582704 16:85011274-85011296 CGCCGCACTCACCCGAGGCCCGG + Exonic
1141879802 16:86850286-86850308 GGCCCTAATCACCCAAGTCCTGG - Intergenic
1142990078 17:3724376-3724398 GGCCGCACACGCTGAGGTCCGGG - Exonic
1147611828 17:41806445-41806467 GGCTGCAATCACCCAGGTCCAGG + Intronic
1158155307 18:54419179-54419201 GGCAGCAGTCAGCTAAGTCCAGG + Intergenic
1160833099 19:1112390-1112412 GGCCGGACTCACCGAACTGCTGG + Exonic
1162479647 19:10920985-10921007 GGCCGCCCTCGCCGCAGGCCTGG + Intronic
1162722023 19:12668249-12668271 GGCCTCATTCAGGGAAGTCCAGG + Exonic
1163715426 19:18869971-18869993 AGCCCCACTCACCGCGGTCCGGG + Exonic
932491660 2:72126815-72126837 GTCTGCACCCACAGAAGTCCTGG - Intergenic
935743808 2:106173997-106174019 GGCTGCAGTCACCTGAGTCCTGG + Intronic
940293478 2:152099151-152099173 TGCCGCGCTCTCCGAAGTGCGGG - Intergenic
942098585 2:172556336-172556358 GGCCGCACTCACCGAAGTCCAGG - Exonic
943716346 2:191156330-191156352 GGCCGCACTCAAAGCTGTCCTGG + Intergenic
944927883 2:204483897-204483919 GGCTGCAGTCAACAAAGTCCTGG + Intergenic
946003071 2:216499084-216499106 GGCCGCGCGCTCCGAAGGCCCGG - Intronic
1173609388 20:44355695-44355717 GGCCGCACTCACCGCCTTCCTGG + Intronic
1176215207 20:63944650-63944672 GGCCGCGCTCACTGATGTCCCGG + Exonic
1178434644 21:32547352-32547374 GCCCACACACACCGGAGTCCTGG + Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1182419356 22:30241427-30241449 GGCCACACTCACCCTTGTCCAGG - Exonic
1183928946 22:41225204-41225226 GGCCCCACTCACAAAAGTCAGGG - Intronic
955003232 3:54946264-54946286 GGGGGCACTCAACCAAGTCCTGG - Intronic
956462450 3:69485439-69485461 GGCTGCAGCCACCCAAGTCCTGG - Intronic
967309424 3:188091996-188092018 GGCCCCACTCACAGGTGTCCAGG + Intergenic
969631039 4:8336839-8336861 GGCCACACACACAGAAGTCAGGG - Intergenic
973533888 4:51861386-51861408 GGCCCAGCTCACCGAAGTCCTGG + Intronic
985518910 5:361537-361559 GGCCCCACTCTCCGAAATCCAGG - Intronic
997627535 5:135341291-135341313 GGCCTCACTCACAGAACCCCAGG + Intronic
1001820982 5:174710097-174710119 AGCCGCATACACCTAAGTCCTGG - Intergenic
1002688471 5:181034077-181034099 CGCAGCACTCTCCGAACTCCTGG - Intergenic
1022246728 7:28567625-28567647 GCCCACACTCACCGAAGTGATGG - Intronic
1032481669 7:132251973-132251995 GGCCCCACTCTCAGAAGACCAGG + Intronic
1035696984 8:1605483-1605505 GGCCGCACTCACTAGAGCCCTGG - Intronic
1039816350 8:41097938-41097960 GGTCACACTGACCGATGTCCCGG - Intergenic
1040059699 8:43093648-43093670 GGCCGCACCCCCCGCAGCCCCGG + Intronic
1042828407 8:73001301-73001323 GGCCGCACTCAAAGCTGTCCTGG + Intergenic
1048612759 8:136041653-136041675 GGCCGTAGTCACAGAAGTACTGG - Intergenic
1049780806 8:144428043-144428065 GGCCGCCCGCGCCGAAGCCCTGG + Intronic
1060354945 9:122897160-122897182 GGCCGCATTCAAAGATGTCCTGG + Intronic
1061196641 9:129110471-129110493 CGCCGCACTCACCACGGTCCTGG + Exonic
1061972322 9:134051415-134051437 GGCCACACTCATCCAAGACCCGG + Intronic
1062698523 9:137887505-137887527 GCCCGCACTCCCGGAGGTCCTGG - Intronic
1187950465 X:24465551-24465573 CCCCGTACTCACCGAAGTCCAGG - Exonic
1193601312 X:83510582-83510604 CTCCGCACTCACCGGACTCCAGG + Intergenic
1199967316 X:152831053-152831075 GGCTGCACCCACTGAACTCCAGG - Exonic