ID: 942098592

View in Genome Browser
Species Human (GRCh38)
Location 2:172556361-172556383
Sequence GGACCTTGGGCCTTTTTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942098585_942098592 2 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098592 2:172556361-172556383 GGACCTTGGGCCTTTTTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 95
942098582_942098592 15 Left 942098582 2:172556323-172556345 CCATGAAGCAGTTCCTGGACTTC 0: 1
1: 2
2: 1
3: 27
4: 241
Right 942098592 2:172556361-172556383 GGACCTTGGGCCTTTTTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 95
942098578_942098592 24 Left 942098578 2:172556314-172556336 CCCCGCTCTCCATGAAGCAGTTC 0: 1
1: 0
2: 1
3: 10
4: 171
Right 942098592 2:172556361-172556383 GGACCTTGGGCCTTTTTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 95
942098579_942098592 23 Left 942098579 2:172556315-172556337 CCCGCTCTCCATGAAGCAGTTCC 0: 1
1: 0
2: 1
3: 33
4: 258
Right 942098592 2:172556361-172556383 GGACCTTGGGCCTTTTTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 95
942098577_942098592 28 Left 942098577 2:172556310-172556332 CCGTCCCCGCTCTCCATGAAGCA 0: 1
1: 2
2: 0
3: 22
4: 188
Right 942098592 2:172556361-172556383 GGACCTTGGGCCTTTTTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 95
942098580_942098592 22 Left 942098580 2:172556316-172556338 CCGCTCTCCATGAAGCAGTTCCT 0: 1
1: 0
2: 3
3: 36
4: 299
Right 942098592 2:172556361-172556383 GGACCTTGGGCCTTTTTGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942098592 Original CRISPR GGACCTTGGGCCTTTTTGCG CGG Intronic