ID: 942098594

View in Genome Browser
Species Human (GRCh38)
Location 2:172556367-172556389
Sequence TGGGCCTTTTTGCGCGGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942098579_942098594 29 Left 942098579 2:172556315-172556337 CCCGCTCTCCATGAAGCAGTTCC 0: 1
1: 0
2: 1
3: 33
4: 258
Right 942098594 2:172556367-172556389 TGGGCCTTTTTGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 36
942098585_942098594 8 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098594 2:172556367-172556389 TGGGCCTTTTTGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 36
942098578_942098594 30 Left 942098578 2:172556314-172556336 CCCCGCTCTCCATGAAGCAGTTC 0: 1
1: 0
2: 1
3: 10
4: 171
Right 942098594 2:172556367-172556389 TGGGCCTTTTTGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 36
942098582_942098594 21 Left 942098582 2:172556323-172556345 CCATGAAGCAGTTCCTGGACTTC 0: 1
1: 2
2: 1
3: 27
4: 241
Right 942098594 2:172556367-172556389 TGGGCCTTTTTGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 36
942098580_942098594 28 Left 942098580 2:172556316-172556338 CCGCTCTCCATGAAGCAGTTCCT 0: 1
1: 0
2: 3
3: 36
4: 299
Right 942098594 2:172556367-172556389 TGGGCCTTTTTGCGCGGTCCCGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942098594 Original CRISPR TGGGCCTTTTTGCGCGGTCC CGG Intronic